*Thread Reply:* Sounds like a brilliant idea! I am not very experienced but would be very happy to help where I can 🙂
*Thread Reply:* Experienced with github you mean?
*Thread Reply:* Oh ok! I could do a tutorial Jitsi call or something.
*Thread Reply:* And then we can write documentation that 'not experienced' people can follow
*Thread Reply:* That would be great, thank you. It seems like a great chance to learn. I’m happy to help find metadata etc.
I think is a good idea. I would set some type of scoring system based on a checklist that the curator can use when adding the samples to the different tables. Like does it have the minimum contextual data we require? Does it have reproducible code? Has the raw data been uploaded to one of the primary databases? Then this score can be integrated in the tables and used to generate the badge. But it should be thought/designed in a way that easily integrates in the workflow of the curator. A similar idea applied for the FAIRness of data, https://github.com/RDA-FAIR/FAIR-data-maturity-model-WG/issues/34
}
*Thread Reply:* I will do a clean up after tommorrow
*Thread Reply:* I would like to invite someone James - I sent them this link: https://spaam-community.github.io/#/?id=standards-precautions-and-advances-in-metagenomics they said this results in Workspace not found
*Thread Reply:* Does this work: https://join.slack.com/t/spaam-community/shared_invite/zt-ei8pfw4m-XdBGTQwRaXWrEkd618YlhQ
*Thread Reply:* (it works for me?)
*Thread Reply:* I have invited them, just thought you might need to know about the dead link
*Thread Reply:* Hm that's wierd though, as that's the link on the link you sent above on the spaam website 😆
*Thread Reply:* Oh well, solved now!
*Thread Reply:* Thanks for reporting anyway 🙂
*Thread Reply:* I hope I remembered correctly who talked about that 🙏
*Thread Reply:* MUSIAL (https://github.com/Integrative-Transcriptomics/MUSIAL) works well as an alt to MultiVCFAnalyzer. It can handle all GATK3 and GATK4 VCFs, as well as those generated by freebayes. It has similar filtering functionality as MultiVCFAnalyzer and generates a SNP table. It came out of a 2019 Tübingen MSc (https://publikationen.uni-tuebingen.de/xmlui/bitstream/handle/10900/89312/Dissertation_Seitz.pdf?sequence=1&isAllowed=y). I think Alexander Herbig was even involved with dev…
*Thread Reply:* zimmerframe
#events: Ancient Biomolecules of Plants, Animals, and Microbes (Virtual Conference) 29th- 31st March 2021 https://coursesandconferences.wellcomegenomecampus.org/our-events/ancientbiomolecules21/
*Thread Reply:* Are you sure we can trust this conference?
*Thread Reply:* Never change a running protocol
*Thread Reply:* Hey Başak, are you somehow working with ancient metagenomic data? We can mostly give the best advice on ancient DNA, but can endeavour to help you regardless (even if with less expertise 😅 )
*Thread Reply:* And for the specific task that you mentioned, you could have a look at nf-core/eager, with the --hostremoval_input_fastq option https://github.com/nf-core/eager
*Thread Reply:* Was going to suggest exactly that ☝️, thanks @Maxime Borry! (although whether to run the whole pipeline or just the script itself depends if you have aDNA data)
*Thread Reply:* hi James, I'm not working with ancient DNA unfortunately. I assumed the basics should be the same 🙂
*Thread Reply:* Thanks a lot Maxime, I'm looking into it!
*Thread Reply:* For “modern” DNA metagenomics, you could have a look to https://github.com/ifremer-bioinformatics/samba or https://github.com/nf-core/mag (talking only about nf-core pipelines)
*Thread Reply:* Thanks, Deeply appreciated
*Thread Reply:* or you can try this https://github.com/SegataLab/preprocessing if you are fluent with python environment.
#events: Bioarchaeology Early Career Conference 2021 with sessions on ethical approaches to excavating human remains as well (on Day 4 Commercial and Museum). Abstract deadline 15th Jan 2021. https://becc2021.com/
*Thread Reply:* On it. Will get back to you in a few days.
*Thread Reply:* Hehe, ok so I'm not on childcare duty today. I just check whta I used in the past: https://biom-format.org/documentation/biom_conversion.html
However, which sourcetracker are you trying to use? The original version (not the QIIME adapted one), accepts just a TSV file: https://github.com/danknights/sourcetracker
*Thread Reply:* I have been using the QIIME adapted version since it will merge and rarefy the sources and sinks.
*Thread Reply:* Ah, then hte first link should work for you. But the R library can also rarefaction I believe (at least that's what I did, because I followed the last example on the README).
*Thread Reply:* I got MetaPhlAn2 relative abundances to work in SourceTracker and all other analyses that require count data and not frequencies by converting the relative abundances into pseudo-counts. I typically opt for 100,000 pseudo-counts to correspond to 100%, so I multiply all my relative abundances with 1,000 (relative abundance in % ** 100,000 / 100) and then work with pseudo-counts instead. No problems so far.
*Thread Reply:* which README? Would either of you mind sharing your commands? I get lost so easily 🤦♀️
*Thread Reply:* README - main page here: https://github.com/danknights/sourcetracker
*Thread Reply:* Here is the code to get the OTU table from the simple MetaPhlAn profile files.
*Thread Reply:* Seems to have worked 🙂
Hi everyone, did anyone ever succeed in installing HOPS the way it is described here https://github.com/rhuebler/HOPS ? I spent quite a lot of time on that and can explain what exactly fails. Perhaps @Alex Hübner or @James Fellows Yates have experience running and installing HOPS?
*Thread Reply:* I would recommend installing it via conda...
*Thread Reply:* At least we use that in eager
*Thread Reply:* And it works
*Thread Reply:* Or is that how you tried to install it and it didn't work?
*Thread Reply:* I also only installed it via conda.
*Thread Reply:* Thanks guys, this is what I get when installing via conda
conda install hops -c bioconda Collecting package metadata (currentrepodata.json): done Solving environment: failed with initial frozen solve. Retrying with flexible solve. Solving environment: failed with repodata from currentrepodata.json, will retry with next repodata source. Collecting package metadata (repodata.json): done Solving environment: failed with initial frozen solve. Retrying with flexible solve. Solving environment: \ Found conflicts! Looking for incompatible packages. This can take several minutes. Press CTRL-C to abor| failed
*Thread Reply:* I tried it on my computer and a computer cluster, same output
*Thread Reply:* Installing it via the shell script “install.sh” can’t get the hops.jar file
*Thread Reply:* Ah shit I guess maybe Ron didn't pin some dependency...
*Thread Reply:* One sec, let me see if u can see the recipe
*Thread Reply:* I can see that the yml-file should probably be modified, for example, “getopt” should be replaced by “r-getopt” and a few other things
*Thread Reply:* Alternatively: install malt and maltextract
*Thread Reply:* And run each step manually
*Thread Reply:* (that's what we do in eager2)
*Thread Reply:* The Rscript for the PDF reports are in the repository from Felix Key
*Thread Reply:* Yes, I have malt and can install maltextract. But is this all HOPS needs? My understanding is that HOPS is a damage-tolerant version of MALT
*Thread Reply:* No HOPS is a pipeline
*Thread Reply:* Yes, a pipeline, but most of the stuff HOPS does I can probably do without HOPS. The thing I can not do is to make a damage-tolerant MALT, that is a peculiarity of HOPS as far as I can see from their publication
*Thread Reply:* MALT already accounts for damage. There is a 'cracked' version of MALT (cmalt) that has a couple of minor changes
*Thread Reply:* https://github.com/rhuebler/cMALT
*Thread Reply:* That should already have a jar file
*Thread Reply:* Post processing is here: https://github.com/keyfm/amps
*Thread Reply:* And finally: you can probably just email Ron to ask him to fix it
*Thread Reply:* huebler@shh.mpg.de
*Thread Reply:* He is still partly active
*Thread Reply:* Yes, I saw it, never tried though, but I thought HOPS should have all the cracking nicely packed together, did not expect it to be a headache to install HOPS
*Thread Reply:* Thank you, I opened an issue on the github, but will also write to Ron
*Thread Reply:* Yeah so hops itself was originally built with slurm integration but the reviewers of the paper (I believe) requested something a bit easier. So maybe conda recipe was done a bit 'fast'
*Thread Reply:* James, does eager2 install HOPS? Or cMALT? If HOPS, how does it do it if the conda installation is broken?
*Thread Reply:* https://www.github.com/nf-core/eager/tree/master/environment.yml
*Thread Reply:* Huh ok, apparently hops!
*Thread Reply:* I suspect it's because we pin the Java version
*Thread Reply:* (the source of most problems...) So if you specify you want to specifically install openjdk 8 alongside the hops package with conda,I guess it will work
*Thread Reply:* Thanks, I will try it!
*Thread Reply:* I had all kinds of trouble installing HOPS earlier in the pandemic-- I wrote to Ron and he sent me a link that was as of March 2020 unreviewed, but worked:
conda install -c <https://99494-42372094-gh.circle-artifacts.com/0/tmp/artifacts/packages> -hops
*Thread Reply:* This worked once I created a new environment for HOPS and then used the above install command:
conda create -n hops_test
conda activate hops_test
conda install -c <https://99494-42372094-gh.circle-artifacts.com/0/tmp/artifacts/packages> -hops
He said review times were of course running slow due to the pandemic, hence passing me this version that “passed all tests” but had not yet been reviewed and therefore was not yet available at the download link. However I imagine that has since changed
*Thread Reply:* I’ve never had luck running the entire MALT-HOPS pipeline in one go though--I have to run MALT and then run HOPS on the output in mode me_po
*Thread Reply:* Oh that's horrible 😱
*Thread Reply:* @Nikolay Oskolkov please let me know Ron said it's still under review. I know a few people on bioconda team
*Thread Reply:* So can expedite the process
*Thread Reply:* I guess if my link works and the download still doesn’t, then they could probably use some expediting… but this was almost a year ago!
*Thread Reply:* Thanks Shreya, are you sure there is “-hops” at the end of “conda install ...” line?
*Thread Reply:* I mean, it should probably be just “hops”, but anyways the command line you posted gives me “UnavailableInvalidChannel”
*Thread Reply:* It should just be “hops”, but I think if the link doesn’t work then it’s probably out of date 😕
*Thread Reply:* I’d definitely write to Ron in that case! He was very helpful to me
*Thread Reply:* James, specifying openjdk=8 in the yaml file did not help either, hopefully Ron can fix this :(
*Thread Reply:* Does it report the exact conflict?
*Thread Reply:* Can you get a verbose output
*Thread Reply:* After some tweaking, the following yml-file worked for me:
Create environment:
conda env create -f environment.yml
name: HOPS channels:
- conda-forge
- bioconda
- defaults dependencies:
- conda-forge::python=3.7.3
- conda-forge::openjdk=8.0.144 # Don't upgrade - required for GATK
- bioconda::hops=0.34
Then I run: conda activate HOPS
*Thread Reply:* and it seems to be working since "hops -h" prints:
hops -h usage: HOPS [-c <String>] [-h] [-i <String>] [-m <String>] [-o <String>] [-v] HOPS version0.33 -c,--configFile <String> Path to Config File -h,--help Print Help -i,--input <String> Specify input directory or files valid option depend on mode -m,--mode <String> HOPS Mode to run accpeted full, malt, maltex, post -o,--output <String> Specify out directory -v,--version Print Version In case you encounter an error drop an email with an useful description to huebler@shh.mpg.de
*Thread Reply:* Thanks a lot @James Fellows Yates and @Shreya for your help!
*Thread Reply:* Do you have an idea what fixed it?
*Thread Reply:* It might be worth checking the hops recipe to see if you can fix it
*Thread Reply:* Previously, I cloned the hops repository and used the yml-file that was in the "Installation" folder. The yml-file looks like this:
name: hops channels:
- bioconda
- anaconda
- conda-forge
- defaults
- R
dependencies:
- openjdk=8
- R
R
- parallel
- r-getopt
- r-gridbase
- r-gridextra
So I created environment "hops" with this yml-file, activated it and ran "conda install hops -c bioconda" within the environment. The idea was that openjdk=8 was pinned in the environment. This way did not work. Then I simply took the yml-file from eager that James posted and apparently this line "- bioconda::hops=0.34" was what made it work. Not sure whether it is the version 0.34 that should have been specified or just it is better to install hops together with creation of the environment
*Thread Reply:* So, in summary:
conda install hops -c biocondaas it is suggested here https://github.com/rhuebler/HOPS, does not work- conda env create -f environment.yml with the following yml-file:
Create environment:
conda env create -f environment.yml
name: HOPS channels: - conda-forge - bioconda - defaults dependencies: - conda-forge::python=3.7.3 - conda-forge::openjdk=8.0.144 # Don't upgrade - required for GATK - bioconda::hops=0.34
Worked for me
*Thread Reply:* I wonder if need to be more precise with the haha version in the hops recipe...
*Thread Reply:* Ok, running "conda install hops=0.34 -c bioconda" in the base environment or in an empty environment created with "conda env create -n myenv" gives me: Collecting package metadata (currentrepodata.json): done Solving environment: failed with initial frozen solve. Retrying with flexible solve. Solving environment: failed with repodata from current_repodata.json, will retry with next repodata source. Collecting package metadata (repodata.json): done Solving environment: failed with initial frozen solve. Retrying with flexible solve. Solving environment: | Found conflicts! Looking for incompatible packages. This can take several minutes. Press CTRL-C to abort. failed
UnsatisfiableError: The following specifications were found to be incompatible with each other:
Output in format: Requested package -> Available versions
But when I create a test environment with the following yml-file:
Create environment:
conda env create -f test_env.yml
name: test_hops channels:
- conda-forge
- bioconda
- defaults dependencies:
- conda-forge::openjdk=8.0.144 # Don't upgrade - required for GATK
Then running "conda install hops -c bioconda" works!
*Thread Reply:* So @James Fellows Yates I think you were right that it is important to create an environment with "openjdk=8.0.144" fixed (even though I actually did "openjdk=8" when using the yml-file from the cloned hops repository)
*Thread Reply:* I think it is not the version 0.34 of hops but "openjdk=8.0.144" that did the job. Mysterious!
*Thread Reply:* Ok, maybe you can can tell Ron and he can update the recipe
*Thread Reply:* Should be simple for him
*Thread Reply:* Yes, will send this to him!
*Thread Reply:* Sorry @Åshild (Ash), we have slurm on our cluster, so I can't say about pbs, but I have not even tested the slurm function of HOPS yet. So far I am using HOPS in a conda environment as you do. Btw, may I ask if you managed to produce sam-alignments with HOPS, i.e. not only the rma6-file?
*Thread Reply:* You could have a try at running it through eager
*Thread Reply:* Nextflow natively supports PBS Torque https://www.nextflow.io/docs/latest/executor.html#:~:text=PBS%2FTorque,The%20PBS%20executor&text=of%20batch%20schedulers.,Nextflow%20manages%20each%20process%20as%20a%20separate%20job%20that%20is,scenario%2C%20the%20cluster%20login%20node|https://www.nextflow.io/docs/latest/executor.html#:~:text=PBS%2FTorque,-The%20PBS%20executor&text=of%20batch%20schedulers.-,Nextflow%20manages%20each%20process%20as%20a%20separate%20job%20that%20is,scenario%2C%20the%20cluster%20login%20node.
*Thread Reply:* Hey Becky, have you thought of Laura Parducci? Her current PhD student Kevin Nota is doing amazing work on plant material from lake sediments.
*Thread Reply:* Thanks Katerina, but we've already had to rule out Laura. Maybe Kevin would be up for it in a few years though!
*Thread Reply:* If you've not already, although it might take a bit of time you could go through the SPAAM attendee list and Google each person to see what they work on and who their supervisor is?
*Thread Reply:* Although I'm assuming you know about this already, there is this you could look through: https://ercapo.wixsite.com/sedadna-society
*Thread Reply:* Already checked SPAAM, but I was woefully ignorant of the society. Thank you!
*Thread Reply:* Thanks everyone - someone we'd assumed didn't want to got back to us today saying actually they would, so we've found an examiner! But I have passed these lists on so hopefully we won't be so desperate again :)
Congrats to @Sterling Wright for his newly awarded grant!
https://twitter.com/Sterling1Wright/status/1365749612494077953?s=19
}
Twitter
Hi, @channel! Check out SPAAM’s fresh new twitter account! While you’re there, fill out this poll to indicate when you would like SPAAM3 to be held.
Twitter
*Thread Reply:* James, as far as i remember in the very first Kraken paper they justified their choice of default kmer equal to 31 as most of the organisms can be reliably distinguished with 30nt kmers
*Thread Reply:* I think there are studies (sorry don't have refs so far) where people trained Naive Bayes classifiers to discriminate between different organisms and concluded that 30nt is a realiable enough sequence length
*Thread Reply:* Ok this is interesting because maybe they do work for aDNA
*Thread Reply:* Despite people saying they don't
*Thread Reply:* yeah, good question about aDNA. In evolutionary science as far as I know, we can use 30nt sequence to quite reliably assign it to an organism (providing that the complexity of the sequence is satisfactory, i.e. it is not a repeat), but whether 30nt is good enough for a damaged sequence, I do not know
*Thread Reply:* Yeah that's my remaining question, I'm not sure how classifiers are with that (maybe you could modify the seed sequence which some use). On the otherhand, damage is only at a frequency e..g. 30% so maybe it's still OK?
*Thread Reply:* damage is not so important as the length of the sequence
*Thread Reply:* My understanding is that a damaged 30nt long sequence will not be classified at all. However, reads longer than 30nt may be damaged and they can still be classified. This is because a read is split into multiple 30mers and each 30mer "votes" for an organism from a database. This means, the 30mers containing damaged nucleotides will not "vote" for any organism (or "vote" for a "wrong" organism) but the majority of 30mers coming from non-damaged parts of the sequence will still vote for a "correct" organism, and the majority vote will still assign a read to a "correct organism"
*Thread Reply:* we have been testing this, for example if you use kraken, you need to tune the DB building
*Thread Reply:* we model first the sequences we want to classify, and then tune the DB building based on this
*Thread Reply:* For example, I know for sure (I tested) that reads with adapters present are still ok to feed to Kraken, they become correctly classified. This means that some "noisy" nucleotides do not influence classification that much
*Thread Reply:* we are going to be releasing soon a full workflow of db building and benchmarking for modern and ancient DNA
*Thread Reply:* using default DBs for short reads like aDNA reads is not a good idea
*Thread Reply:* This is satisfying to know @Nikolay Oskolkov! Because then my understanding of the system is correct 😆
*Thread Reply:* @Antonio Fernandez-Guerra by modelling you mean te k-mer distibution?
*Thread Reply:* different parameters
*Thread Reply:* k-mers, read lengths, damage
*Thread Reply:* then we build synthetic data sets based on this to tune the DB buikding process
*Thread Reply:* > using default DBs for short reads like aDNA reads is not a good idea In what way? The k-mer distributsions (or hash-maps, or w/e) are 'polluted' with stuff that could result in false positives or something?
*Thread Reply:* similar happens with sourcetracker, we are also developing a new version of meta-sourcetracker that takes in account all the aDNA singularities to create proper sources
*Thread Reply:* @Antonio Fernandez-Guerra so you are building a "project-specific" database that matches your sequencing data?
*Thread Reply:* But that requires pre-knowledge what you want then, right?
*Thread Reply:* Sounds cool though 😄
*Thread Reply:* @James Fellows Yates this is how we design e.g. a MALT database, we build it in a project-specific way
*Thread Reply:* So you say you are specifically looking for species: X, Y, Z?
*Thread Reply:* in our case we model the characteristics of the data
*Thread Reply:* so we are more in the way of what are the best parameters to classify sequences like this
*Thread Reply:* we don’t care who is in the pot so much as we do full ecosystem reconstructions
*Thread Reply:* What we do, we screen our samples (thousands) with KrakenUniq and select most reliable (using breadth of coverage as a criterion) organisms present in at least one sample, and use those organisms to build a MALT database for further aligning the data with MALT
*Thread Reply:* Ok cool,that's what I'm also intersted in @Antonio Fernandez-Guerra.
*Thread Reply:* Ah ok @Nikolay Oskolkov so you do generic pre-screening then validate with MALT after. Understood 👍
*Thread Reply:* we use many similar concepts that the ones described here https://instrain.readthedocs.io/en/latest/important_concepts.html
*Thread Reply:* @James Fellows Yates Exactly! We do not use MALT for screening because of many reasons (it is too slow, has a limited size database, needs lots of RAM), so we screen with KrakenUniq against the full NT and use MALT for validation
*Thread Reply:* especially for the DB construction
*Thread Reply:* OK good to know I'm not alone in going in this direction then.
And looking forward to seeing the outcome of that project @Antonio Fernandez-Guerra , sounds exciting!
*Thread Reply:* we are trying to improve what you can get from mt-sourcetracker and it also works nicely to get better taxonomic annotations
you might want to read this https://www.nature.com/articles/srep28840
*Thread Reply:* it has refs that can be useful like https://link.springer.com/article/10.1186/gb-2009-10-10-r108
*Thread Reply:* these ones also might be of interest as it relates k-mers with species boundaries https://academic.oup.com/mbe/article/34/10/2716/3976054 https://www.biorxiv.org/content/10.1101/569640v5
*Thread Reply:* I'm actually interested in non-prokaytotes but thanks!
*Thread Reply:* i am quite biased on this, but the basics should be the same
@James Fellows Yates I was hearing to the talk at the bottom of this message and there they sort of tested it for the 1My mammoth at their conclusion was that below 35-30 it does not really work. I remember that Simon Rasmussen also tested that computationally and as a conclusion of his tests he was also using a min length of 30 bp. https://www.youtube.com/watch?v=LOVdbayRBns
*Thread Reply:* The leipzig group at EVA also showed this. Going lower (e.g. 25bp) only works when you have exact SNPs they were interested (in well studied neanderthals, so doesn't really help here)
*Thread Reply:* What is the state of the uploaded data? DOes it have index+adapter+barcode? Or just barcode?
And do you have the barcode list in the paper?
*Thread Reply:* demultiplexed+adapter removed&quality-trimmed. Internal index (barcode) still there
*Thread Reply:* I’d have to find the list, but I won’t get to it today, I can do it tomorrow
*Thread Reply:* They’re 6bp and you can see them in the FastQC report
*Thread Reply:* Wonderful thank you
*Thread Reply:* Almost all of our data is with internal barcodes, some published, some not yet. Happy to share
*Thread Reply:* Does this have what you need? I can’t find the index sequence for CS05 (there was a lot of confusion about the correct internal index list at the time)
*Thread Reply:* That's perfect @ivelsko!
@Katerina Guschanski hehe I was hoping you would say that ;). If you could somehow supply e.g. 3 unmerged/untrimmed libraries with adapters and internal barcodes with the barcode list, subset to just the first 10,000 reads that would be amazing. I can also do the subsetting if you need.
*Thread Reply:* Oh and also the ERR code for each library so I can cite in the test data documentation
*Thread Reply:* Do you dual barcode? Or just single?
*Thread Reply:* Gonna ping @Jaelle Brealey here in the hope that she'll be able to supply what you need. Wonder if the published data has what you need. If not, Jaelle, I'm happy with sharing the unpublished sequences for the AMR study
*Thread Reply:* Dual barcode, dual indexing
*Thread Reply:* Meaning 2 internal barcodes and 2 indices in the Illumina adapters
*Thread Reply:* That is perfect!!!
*Thread Reply:* I think ENA requested that internal barcodes were hard-clipped from the 5' end of the reads before uploading, so the published data won't be appropriate. I'll check the data from the unpublished study and get back to you in the next few days 🙂
*Thread Reply:* Yeah ok, that's what I expected as they don't want technical artefacts.
Thank you very much!
*Thread Reply:* @James Fellows Yates I can send along the raw fastq's for a few of our samples today -- ones with dual indices and internal barcodes. Also have the barcode and index information in a spreadsheet. How do you usually set up transfers? Do you want to DM me the details :)
*Thread Reply:* Hi Adrian! That would be great!
That all sounds great! DM is fine. And I don't mind how you ship it - I'm flexible , whatever is easier for you!
Congratulations to @Anneke ter Schure!
https://twitter.com/Anneke_tSchure/status/1376195685272408070?s=19
}
Twitter
}
Twitter
*Thread Reply:* @Kelly Blevins I just looked at the website and it has September 2020.
*Thread Reply:* I fixed it, but it hasn’t updated yet
*Thread Reply:* Maybe @Maria Spyrou can help!
*Thread Reply:* Hey Jessica, sorry for replying so late! Happy to discuss more via email 🙂
*Thread Reply:* Hi!! The submission for abstracts is still open and we are happy for more submission! SPAAM3 is thought as more of a discussion conference if that makes sense, so beginners are more than welcome to present their work and the challenges they are facing. We are Looking forward to your submission :) and if you have any other questions let me know!
If anyone is regularly using MALT (or MEGAN), I've made a bash wrapper script for a command-line way of going from rma6 ➡️ OTU table without having to open MEGAN (I got fed up having to download all my RMA6 files to my laptop or set up megan-server each time...):
Feedback gratefully received
https://github.com/jfy133/rma-tabuliser
*Thread Reply:* Thanks a lot James! Wouldn’t MaltExtract run on the RMA6 files produce a similar count table of microbial abundances?
*Thread Reply:* No, because you have to specify a taxon list to MaltExtract, and then you only get results for those taxa
*Thread Reply:* The new script allows you to do it without prior knowledge what is in your samples
*Thread Reply:* Ah, I see, interesting! I would guess you might get too many microbes then, and majority will probably be false-positives, because I guess you can't really check the breadth of coverage on the fly when generating the count table?
*Thread Reply:* I indeed quantify microbial abundances (with MaltExtract) for a specified list of taxa that previously passed breadth and depth of coverage filters
*Thread Reply:* Oh, I just thought, you actually know what taxa were included into the MALT database, so you can provide this full list list to MaltExtract, and get a count table that should be equivalent to the one obtained by rma-tabuliser, is my understanding correct?
*Thread Reply:* 1) yes correct, but depends on your purpose ;) 3) yes at a fundamental level you could, exactly. However rma-tabuliser has a few extra functionalities derived from Megan e.g. export taxids rather than names, export all assignments at higher taxonomic levels (so you don't have to manually make higher level name lists), and you can use it for functional teams tables as well (kegg, seed etc) that you can also get from rma6 files
*Thread Reply:* In other words is more lightweight and focuses purely on whereas maltExtract has all the extra authentication stuff
*Thread Reply:* Purely on ount tables
*Thread Reply:* Ach fuck slack
*Thread Reply:* You get the point
*Thread Reply:* Right, I think I got it! Thanks a lot for sharing James and I will try to test it. Currently, I am quantifying microbial abundances from RMA6 files with MaltExtract but would be curious to compare this way with rma-tabuliser 🙂
*Thread Reply:* Yeah might make more sense in this case, particularly if you want to compare e.g. genus abundances rather than species, for example
*Thread Reply:* You should get approximately the same output, but I expect rma-tabuliser to be faster (not confirmed though)
Did anyone else get an email e.g.:
*Thread Reply:* I don't know what that is either! I am properly subscribed and did nothing to promote it (at least intentionally)
Please give your opinions!
https://twitter.com/jfy133/status/1423564438859288579
}
Twitter
Hey, @channel! SPAAM3 is just around the corner on September 1-3! Here is the complete program, one in PT and one in CEST. You can also find the program on the SPAAM-community website. Love what you see but didn’t register? We still have a few slots left. Contact one of the SPAAM3 organizers to register and attend!
*Thread Reply:* Looking at you @Anna F. for name suggestions 😉
*Thread Reply:* Just for clarification: “our” website is spaam-community.github or mpi-eva?
*Thread Reply:* spaam-community.github of course!
*Thread Reply:* Would be super interested in reading it! Think this is a fantastic initiative!
*Thread Reply:* As a novice on the topic, I would love to read more accessible pieces on terminology, methods, etc, something that would make it easier to read full papers and understand conference presentations!
*Thread Reply:* I also like the idea and would read it
*Thread Reply:* I would also read it! Might even be easily convinced to write something for it.
*Thread Reply:* This is very nice too. I don't think it will necessarily need someone in charge of this. It could be just done by the community itself: each time someone wants to announce something, it can just do it by following a set of instructions indicated in the blog itself
*Thread Reply:* Wonder, do we need that on top of the Slack channels? Is it primarily targeted to people not on Slack?
*Thread Reply:* the blog would reach a broader audience, perhaps not everyone wants to join the slack channel especially if only interested in some aspects
*Thread Reply:* I am happy to do some monitoring and maintenance
*Thread Reply:* Ok, maybe we can find other volunteers as well in SPAAM3
*Thread Reply:* Love the blog idea and tentatively down to help maintain, if I could learn more about it!
*Thread Reply:* Would be relatively straight forward! Just checking submissions 🙂
*Thread Reply:* I'm also happy to help monitor and maintain!
*Thread Reply:* Good idea
@aidanva @Miriam Bravo @Kelly Blevins @Betsy Nelson do you think there would be time/scope to talk about this during SPAAM3?
*Thread Reply:* We could discuss it on the last day, after the tools session
*Thread Reply:* @Betsy Nelson @Miriam Bravo @aidanva @Abby Gancz @Shreya @irinavelsko @Alex Hübner @Lucy van Dorp @Marcel Keller
Ping you guys as you've shown some interest. I decided after talking to a couple of people having such a day would be the most efficient to get it 'done'
*Thread Reply:* @Maxime Borry
*Thread Reply:* Everyone is also very welcome to contribute to developing the tool as well 🙂
*Thread Reply:* @Katherine Eaton if you're still working in the field, maybe something you'd be interested in ? 😉
*Thread Reply:* How much genetics knowledge is required for this? If it's relatively simple data-entry, I can help if needed.
*Thread Reply:* If you can read a paper and find keywords it should be relatively straight forward!
*Thread Reply:* We can also pair people up in mentor-mentee systems
*Thread Reply:* The more the merrier!
*Thread Reply:* I’d really like to help! But I’m on NYC time so I’m wondering if there’s any way I can do a second ‘shift’ sort of thing (like starting at 7am my time instead of 3am). Since I’m new to it all it I understand if that doesn’t work for getting up to speed, but thought I’d ask!
*Thread Reply:* Hi @Olivia! Please still sign up, it would be great to have you!
There are already a few others also in N. American who have signed up, including some AncientMetagenomeDir experts.
I will also plan to continue for a bit in the evening my time as well so can help initiate the second shift and get everyone up to speed :)
*Thread Reply:* Would love to help if I can, I am in Brisbane Australia time zone
*Thread Reply:* @s.wasef please still sign up, depending on how many people from each time zone sign up we can adjust accordingly 🙂
*Thread Reply:* Intrigued by helping @Maxime Borry with the tool!
*Thread Reply:* @James Fellows Yates, I'd be keen to be involved as well if it's not too late! Sorry, only just joined the slack today. Let me know if you can still use someone. I'm based in New Zealand.
*Thread Reply:* Oops, sorry missed this thread sorry @Meriam van Os! Will send you the detials. Do you have a google account? I can then send the google calendar invite. I also saw you sent your github account, will add you to the repo now
I've just made a new release of my R package for visualising the endogenous content of ancient microbiome samples (used to help you filter for preservation): https://twitter.com/jfy133/status/1437742951237627904
Twitter
*Thread Reply:* Just makes you a bit more human 😂
*Thread Reply:* At least the command is right!
*Thread Reply:* > Just makes you a bit more human Shh don't tell anyone 😉
*Thread Reply:* He does it on purpose so we THINK he's actually human 😆
*Thread Reply:* Ziesemer, K. A., Mann, A. E., Sankaranarayanan, K., Schroeder, H., Ozga, A. T., Brandt, B. W., Zaura, E., Waters-Rist, A., Hoogland, M., Salazar-García, D. C., Aldenderfer, M., Speller, C., Hendy, J., Weston, D. A., MacDonald, S. J., Thomas, G. H., Collins, M. J., Lewis, C. M., Hofman, C., & Warinner, C. (2015). Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification. Scientific Reports, 5, 16498. https://doi.org/10.1038/srep16498
?
*Thread Reply:* Super Jamie at rescue, once again!
*Thread Reply:* If the world was full of James it would certainly be a better place
*Thread Reply:* Although the article mostly answers to my question, I still wonder if differences in beta-diversity analyses would follow a similar trend between 16S and shotgun, despite the big differences in the taxonomic profiles of both approaches
*Thread Reply:* But the point is you can't get a good estimate of (ancient) diversity though, because of the skew?
*Thread Reply:* I see what you mean. But imagine there is a group of samples that is more similar to each other than to a second group of samples. Would we see this clustering anyway, even having the huge 16S bias?
*Thread Reply:* We did that here too
But I’m not sure if it answers your question as each group was treated differently.
Also we didn’t compare them to other groups and so I can’t answer your question about beta diversity
https://www.nature.com/articles/s41598-021-86100-w
*Thread Reply:* Thanks Sterling! Yes, I had this paper in mind. I will re-look at it with my question in mind
*Thread Reply:* Sounds good if you need any help.
*Thread Reply:* Hi Abby, I can help you
*Thread Reply:* so basically, I have an fna file of reference genomes from a collaborator
*Thread Reply:* I've been trying to build a database (which is what I think I need to do)
*Thread Reply:* and that seems to work, except there are no classifications
*Thread Reply:* am I doing something completely wrong?
*Thread Reply:* @Ian Light as well I believe uses it
*Thread Reply:* @Abby Gancz yes, you build a custom database with krakenuniq-build from fasta file of concatenated reference genomes. I hope those are a number of reference genomes in your case, from multiple organisms, i.e. not just a few. By “no classifications” you mean that 100% of reads are unclassified?
*Thread Reply:* I am not sure whether I referenced the input file correctly though
*Thread Reply:* I made a 'library' folder and put the genomes in there, then run the build command
*Thread Reply:* Seems right. As far as I remember, krakenuniq creates a file_list.txt with the list of reference genomes included into the database, perhaps it is worth checking that all your ref genomes are there. Second, how heavy are your database.kdb files? I mean if something went wrong, they might be empty
*Thread Reply:* Is it microbial ref genomes or eukaryotic / mammalian?
*Thread Reply:* I would also add your ref genomes from collaborator to the other microbial genomes that can be downloaded by krakenuniq from ncbi. You need some “background genomes” for classification even though you expect most of your reads to be assigned to the ref genomes from collaborator
*Thread Reply:* Would a single fna file be fine as an input?
*Thread Reply:* I'm wondering whether that is the issue
*Thread Reply:* Abby, how many ref genomes are within the fna file?
*Thread Reply:* So it seems like the problem is in the database building step, where it's saying al the sequences are unclassified
*Thread Reply:* do you know how to deal with that?
*Thread Reply:* hmm, or maybe this is because I forgot the mapping file 😑
*Thread Reply:* This may be a dumb question, but is there a way to get taxonomy IDs from the fna file?
*Thread Reply:* hmm, the db building step says that the sequences are empty
*Thread Reply:* Abby, do you have headers in the fna-file?
*Thread Reply:* May I have a look at a few lines / characters of the fna-file?
*Thread Reply:* >NC_012975.1 Oryzias GCTCACGTAGCTTACCTAAAGCATGACACTGAAGATGTTAAGACAAACCCTAGAAAGTTT CGTAAGCACAAAAGTTTGGTCCTGACTTTACTGT
*Thread Reply:* Hmm, the ref genomes present in the fna-file should have a conversion assession2taxid-file. I think, it is not enough to just have a fna-file
*Thread Reply:* Hey @Nikolay Oskolkov, any chance I can get example files for KrakenUniq database construction? Including the taxonomy ID mapping
*Thread Reply:* @Abby Gancz did you figure this out? I am in a similar boat and maybe we can spare Nikolay from explaining everything!
*Thread Reply:* (specifically going from fasta to the mapping file)
*Thread Reply:* Still working on it, but I'd be happy to fill you in once we find a solution
*Thread Reply:* We do have a super clunky script that looks up the taxID and pastes it, if that helps
*Thread Reply:* Sigh I was afraid it’d be clunky script writing time… keep me posted!
@channel another reminder, if you have any ideas of projects/events/tools anything you think would be an interesting community/collaborative project, please feel free to add your ideas to the GitHub project board: https://github.com/orgs/SPAAM-community/projects/1
(If you don't have/want a github account, message me and I can add it for you)
*Thread Reply:* PS if you’re American we call Agony Aunts advice columns out here but I like the British version more ✌️:skintone5:
*Thread Reply:* Hi @Guillermo Rangel and welcome! If the issue is specifically about nf-core/eager it would be better to ask on the nf-core slack under #eager (https://nf-core/join)
*Thread Reply:* But if your question is specifically to do with e.g. what parameter or database to use, for example, then you can ask on <#C02DCKJ54JX|no-stupid-questions>
*Thread Reply:* cool, thanks for your reply James 🙂 I’ll join both of those channels
*Thread Reply:* Hi @Andrea quagliariello sorry for the slow reply, a lot of us were in an event for #ancientmetagenomedir!
AFAIK not much has been done for plaque/calculus in regards to diet.
Some papers have suggested there is a difference (Adler 2013, Weyrich 2017), but we were not able to replicate these results when we compared Gorillas/Chimps/HUmans etc (Fellows Yates 2021). However because of the complexity of the oral biofilm it might be quite hard to distinguish changes due to diet vs. other aspects.
In the SI of our paper (section S4.5) we also have examples of papers from modern microbiomes showing very very minor differences due to diet (see references in the last paragrph), and instead (our group anyway) think that looking at funtional differences will be a better way to track this, rather than taxonomic profiles.
*Thread Reply:* Hi @Andrea quagliariello there is very little work done on diet and calculus. To find papers, your best bet would be a PubMed search, order results by recent, go to the oldest papers, and move forward through them. Any work that was done is likely to be older, done in animals, and published in dental journals, ie https://pubmed.ncbi.nlm.nih.gov/5230026/
*Thread Reply:* Hello @James Fellows Yates and @ivelsko, thanks a lot for your reply. Don’t worry I knew you were all busy that day, unfortunately I was not able to join your meeting, hoping to be part of it next time. I took a look at pubmed and as I suspected there are very few information about the theme. @James Fellows Yates I totally agree with you; I think that the analysis of functional pathways may be more sensitive to detect possible dietary-linked influence rather than specific bacterial markers.
*Thread Reply:* I'm going to shamelessly ping specifically 😉 @Katerina Guschanski @Nico Rascovan @Freddi Scheib@Felix Key @Hannes @Antonio Fernandez-Guerra @Pete Heintzman
If you wanna help make your student's lives easier downstream 😉 (also because in the future want to start talking about developing a standard MIxS template that ancient metagenomicists can use to upload stuff [currently without requesting new fields, but could extend in the future])
*Thread Reply:* Thanks, but unfortunately I can't take on anything new until after March 22. Maybe round 3.
I finally uploaded my coverage/edit distance/deamination plotting script to github as promised during SPAAM3 so I am shamelessly plugging it here: https://github.com/MeriamGuellil/aDNA-BAMPlotter
*Thread Reply:* You should totally put it on bioconda
*Thread Reply:* Looking at the dependencies it would be quite straight forward
*Thread Reply:* haven't uploaded anything to bioconda yet (even though I love conda) I will check it out. Thanks!
*Thread Reply:* You basically just need to make one yaml file with download link of the release, md5sum, which license and then a list of dependencies.
*Thread Reply:* As in not even uploading anything
*Thread Reply:* Let me know if you want any help or advice doing it
*Thread Reply:* You even just copy Aida's endors.py file 🤔
*Thread Reply:* She's done it before
*Thread Reply:* Thanks @Meriam Guellil! Just tried it and it's awesome 😁
That also reminds me, while we are sharing, last week some of us released a github template on how we plan to standardise the structure of our bioinformatics projects in our group (where to place files, how to document things etc.): https://github.com/paleobiotechnology/analysis-project-structure
It's publicly available, and also works with the python 'cookiecutter' (thanks @Maxime Borry!) to insert your project name in all the relevant places.
Feedback welcome, and feel free to use it!
*Thread Reply:* Ooh just in time for me to try it out! 😁
@channel reminder of AncientMetagenomeDir Metadatathon round2 (*important*: you can still join if you DIDN'T join the first one!), please select a day that would work best for you here:
https://spaam-community.slack.com/archives/CPYE64ZC6/p1636362046018300
I will shut the doodle end of this week! So plesae sign up if yo uwant to be included in any future publication that may arise!
}
*Thread Reply:* It loaded for me, but it took a moment
*Thread Reply:* Then it's just me
*Thread Reply:* OK now it works
*Thread Reply:* Thanks or checking!
*Thread Reply:* Hi James, Is too late to join this interesting project? 🙂
*Thread Reply:* Nope! This got a bit delayed for a variety of reasons, I'm planning on setting up the next meeting tomorrow
*Thread Reply:* Great, thanks you James!
*Thread Reply:* @Mohamed Sarhan please join <#C01BX7EM4EL|metadata-standards> to keep up to date
For everyone joining from the sedaDNA society, please see the pinned posts for possibly relevant channels: https://spaam-community.slack.com/archives/CPYE64ZC6/p1632471482043200
*Thread Reply:* Maybe #wet-lab would be more suitable?
*Thread Reply:* (to make it more broad?)
*Thread Reply:* or just #protcols
*Thread Reply:* But agree in general thereisn't a really suitable place atm
*Thread Reply:* You're welcome :)
Do check the output though, I never tested it super thoroughly...
*Thread Reply:* As in I nicked the column merging awk command off of stack overflow
*Thread Reply:* And it worked in all my tests but I still don't really understand how it does it 🤣😬
*Thread Reply:* https://github.com/jfy133/rma-tabuliser/blob/main/rma-tabuliser#L267-L271
*Thread Reply:* Ha-ha, thanks for pointing out! 🙂 Quite a piece of code 🙂
*Thread Reply:* First issue is that the logo on the left corner is cut. That depends on the size of your screen. Try on other screens and you will see. The way to overcome is to have shorted text below (or less links)
*Thread Reply:* yeah @Maxime Borry also noticed a problem on mobile too
*Thread Reply:* I was actually trying to do that, but I was trying by forking the original hydrout and copying the bits I wanted from sedaDNA
*Thread Reply:* Didn't work so well it seems 🤦♀️:skintone3:
*Thread Reply:* yes I struggle hard too. So my way was to fork from mersorcium and play a bit with parameters later.
*Thread Reply:* But it indeed took me few days to get how to do that ^^
*Thread Reply:* If you fork directly the sedaDNA website, I could guide you to change colors and shapes
*Thread Reply:* 👍 I have a closed-Kita situation atm, but I'll look into it when I have free time again! Unless you have time to make a fork from yours in the SPAAM organisation and tweak it as per what is already there? Regardless, I will add you ot hte SPAAM github
*Thread Reply:* you should have an invite
*Thread Reply:* Overloaded right now too, sorry but I will later
Hi @channel,
We are very excited to announce that SPAAM4 is currently in the making and will be held virtually in Autumn 2022 🎉
Similarly to past years, we have designed a questionnaire to help us tailor the conference to the SPAAM community, to gauge interest and ensure we can all get as much out of this conference as possible!
Please fill in this questionnaire by the Friday 25th March https://forms.gle/eLqN28AxKUHCZJfe9
Also remember to follow the SPAAM twitter account, slack channel and join the mailing list (which can all be found at tinyurl.com/snj9azch) to ensure you don’t miss out on SPAAM4 updates!
Helping all your ancient metagenomic dreams come true,
SPAAM4 Organisers @Abby Gancz @Gunnar Neumann @Nasreen Broomand @Rita M Austin @Shreya @Pooja Swali
(Please feel free to contact any of us with any further questions!)
*Thread Reply:* Tienes una problema... @Nico Rascovan
*Thread Reply:* hahaha, with the nicknames ?
*Thread Reply:* I only use them with the people that I like 😉
*Thread Reply:* well that's just wierd
*Thread Reply:* The diminuitives yes...
*Thread Reply:* it’s even worst, not only diminutives, but I can come with any sort of weird name… but they are all stemming from pure love.
Hello @channel!
Just a short reminder: Please, remember to fill out our questionnaire for this year’s SPAAM4 meeting by Friday 25th March. You have three days left. https://forms.gle/eLqN28AxKUHCZJfe9
Your input will help us to find a date that will fit as many people as possible in our community and to prepare a program to spark the interest of everyone!
Congrats to @Ele!!!
}
Twitter
*Thread Reply:* It was a perfect poosentation!
*Thread Reply:* Yay for non-standard funding!
*Thread Reply:* Will you disclose your sources?
*Thread Reply:* The Palaeobiotechnolgoy one from the Werner Siemens-Stiftung: https://www.wernersiemens-stiftung.ch/en/projects/ancient-medicine
*Thread Reply:* Tina and Pierre also added a request for teaching/training support too
*Thread Reply:* Great stuff!
@channel summer school is now official announced! https://twitter.com/spaam_community/status/1519973404866224130
Twitter
*Thread Reply:* Any chance of auditing (or will there be recordings)? My summer schedule is a total mess and I also don't think I qualify as early PhD 😛
*Thread Reply:* We plan to make everything available online after, but no guaruntee
*Thread Reply:* @Eric Capo maybe you oculd share with the sedaDNA mailinglist/twitter?
*Thread Reply:* Yes I will definitely do that (within next week). Well done for organizing that!
*Thread Reply:* @James Fellows Yates Maybe adding the word "sedimentary DNA" or molecular data preserved in environmental archives to the description of the summer school description would help you to get some people from the society. Because the description now is about "degraded DNA content of archaeological and paleontological specimens" and that excluded "molecular ecologists"
*Thread Reply:* That's actually on purpose 😬
*Thread Reply:* We will focus almost exclusively on host-associated stuff, because that is where our expertise is. However may of the concepts are transferable, as we will be going quite basic like - how to work on a terminal, and this is what a taxonomic profile does - rather than 'how to pick database, or select X markers for Y context).
*Thread Reply:* Ok I understand that this need to be specific so but then I was confused by this sentence in the description of the summer school "how past ecosystems changed in response to long-term climatic and anthropogenic change". This is clearly targeting environmental archives right?
*Thread Reply:* I have a Romanian colleague who is technically not a student right now. She will be starting her master's in September. Is it okay for her to apply?
*Thread Reply:* Great thank you!
Hi all! It's the moment you've all been waiting for--SPAAM4 dates are now announced! Mark your calendars, SPAAM4 will take place October 12-14, 2022. That's 3 half-day sessions full of science, microbes, and maybe...romance? A lot of love for microbes, at least! There will be conference-style presentations, community-building opportunities, and more. At SPAAM4, the world is your oyster (unless you're Vibrio vulnificus--then maybe the oyster is your world?). Registration and abstract submission forms will be posted in the next few weeks. SPAAM4: The perfect marriage of conference and community. Don't miss it!
*Thread Reply:* Really looking forward to this! I remember reading somewhere that in-person participation may be possible. Is there any news?
*Thread Reply:* We are waiting to see who we select (currently have 3:1 applicant: place ratio) and will make a decision then
@channel Registration and abstract submission for SPAAM4 are open! In case you missed it when we sent out our beautiful and very normal Save The Date: SPAAM4 will happen over three half-days (October 12-14, 2022). There will be conference-style presentations, community building opportunities and more. Spots are limited, so snag your spot early!
Register here: https://tinyurl.com/SPAAM4Reg Submit an abstract here: https://tinyurl.com/SPAAM4Abs
@channel I've just discovered Slack has rolled out for all plans the ability to display 'Pronouns' (and soon name-pronunciantion guides!) on Slack profiles. I've now activated this for the SPAAM workspace.
To update:
- Click your face
- Press 'Profile'
- Press 'Edit profile'
- Add your pronouns to the field
- Press Save changes. then if you click on someones name, or press your own face > profile again, you should see them under your name.
I highly recommend adding pronouns and also pronunication (when htat's rolled out), particularly as we start expanding outside western/European-baesd languages to make it easier for everyone to communicate and chat with each other :)
*Thread Reply:* I remember this happening to @James Fellows Yates who figured out that they changed the url
*Thread Reply:* If you run into any issues, I should be able to help. I am the one who uploaded them.
*Thread Reply:* Downloaded without any issues, thanks Sterling!
Dear @channel ! Just a little reminder to register for the upcoming SPAAM4 meeting in October! Register here: https://tinyurl.com/SPAAM4Reg Registration deadline is September 12th.
Also, share your exciting work, results and thoughts with the SPAAM community and submit your abstract here: https://tinyurl.com/SPAAM4Abs You have less than a month left as submission deadline is August 1st!
Congrats @Pete Heintzman!
}
Twitter
}
Twitter
*Thread Reply:* Oh wow... Table 2 and 3 are missing 👀
*Thread Reply:* Anja is in our department, I'll ask her
*Thread Reply:* Apparently the publisher didn't upload those tables... They were in a separate file. Anja sent them to me (attached) and said she'll ask them publisher to upload them as well :)
Hi @channel! Bummed that you missed the SPAAM4 abstract submission deadline? You're in luck! We are extending the abstract submission deadline for SPAAM4 to August 15. The abstract doesn't have to be fancy or discuss results, just pitch us your ideas! Submit here: https://tinyurl.com/SPAAM4Abs
@Maxime Borry and myself (among others) are looking for some help/suggesitons:
https://mobile.twitter.com/me_beber/status/1563926235717173248
}
Twitter
*Thread Reply:* I see now. I would be interested in knowing how this could be done without taking an exorbitant amounts of memory. We run into this issue a lot with our current workflow.
*Thread Reply:* I don't think you can assume that mineralization will destroy/degrade the DNA. Hydroxyapatite binds DNA very well, and this actually protects it from breaking down. B/c of that property, hydroxyapatite-DNA binding is used for industrial purposes
*Thread Reply:* Do we know how they are protected from degeneration by HA? since we don't entirely know the exact mechanism of mineralisation, could it cause damage to the DNA (even before binding), if, as proposed in an an article I read but can't quite remember, the mineralisation of bacteria starts from within the cell?
*Thread Reply:* The negatively charged backbone of DNA binds the positively charged HA molecules, which then protect it from degradation by hydrolysis and enzymatic activity. I've heard the hypothesis that mineralization is nucleated by the DNA, and the HA molecules grow up the backbone
*Thread Reply:* If you google "hydroxyapatite growth on DNA" you'll get a lot of papers about hydroxyapatite growth on DNA. All synthetic systems, but they probably describe how it happens, and it's possible the same occurs in bacterial cells
Shame(ful) self promotion: https://twitter.com/jfy133/status/1567051387426439171
If anyone here is using eager, please let us know what you're unhappy about/what improved!
Twitter
*Thread Reply:* If no one else has showed interest, I can do it.
*Thread Reply:* I'll add you to the list
*Thread Reply:* If suggestions
*Thread Reply:* That sounds great! Thank you
*Thread Reply:* I think endogenous is most common but also imprecise. If I could choose I would go for “target”. There might be cases where you actually want to look for an organism that’s “exogenous”.
*Thread Reply:* Yup, I agree. But I'm looking for a list of all possible terms 😬
*Thread Reply:* yes I stopped using endogenous because it made little sense for pathogens. I usually go with something in the lines of %target taxon/refseq
*Thread Reply:* refseq being?
*Thread Reply:* depends on what I was using but chances are when you map you don't have a pangenome reference so taxon can be misleading too
*Thread Reply:* I would also use “XX targeting reads” (on a given genome)
*Thread Reply:* I meant more specifically the normalised version that allows you to compare (and set a threshold for Y/N on sufficient preservation)
*Thread Reply:* https://github.com/jenniferlu717/KrakenTools
*Thread Reply:* Thats Kraken only
*Thread Reply:* Or rather whne I ran the command
*Thread Reply:* it gave an error
*Thread Reply:* But it does say in the description!?
*Thread Reply:* Since they state "KrakenTools is a suite of scripts to be used for post-analysis of Kraken/KrakenUniq/Kraken2/Bracken results." you'll have to email them
*Thread Reply:* I think outside of these tools there is only pavian as an "official tool"
*Thread Reply:* thakn you both!
*Thread Reply:* @James Fellows Yates regarding your first question, I am using a custom R script that combines multiple KrakenUniq outputs into a single abundance table, can share the script if you want, it is also included into our upcoming workflow release. Regarding the second question, I unfortunately use one command line per sample, would love to know if it is possible to use multiple inputs. I got a feeling from @Meriam Guellil’s presentation last SPAAM that she loaded the DB only once and processed multiple fastqs. This is probably what you are looking for, right? If so, I never managed to do it like Meriam but perhaps I am not aware of some magic flags 🙂
*Thread Reply:* I think krakentools does support combining report-style output apparently, but I'm getting an error I'm looking in to
*Thread Reply:* Thanks for the offer on the script! I'm looking more for an official tool (basically already on bioconda), but I might come back to you for that
*Thread Reply:* yes I load the DB once and then loop through the files. And I combine the outputs in python using mostly pandas
*Thread Reply:* Do you have a little code snippet you could share @Meriam Guellil?
*Thread Reply:* or rather db load and loop
*Thread Reply:* This should do the trick:
krakenuniq --db ${DB} --preload --threads ${threads}; while read sample; do
krakenuniq --report-file REPORT --fastq-input FASTQ --gzip-compressed --db ${DB} --threads ${threads} --only-classified-output > KRAKEN
done < sample.list
*Thread Reply:* with some variable shenanigans for the file names
*Thread Reply:* thank you! that's really helpful!
*Thread Reply:* I've used Pavian to do this is the past, although it's not an ideal solution.
https://github.com/fbreitwieser/pavian
*Thread Reply:* Yeah I need a cli tool unfortunately
*Thread Reply:* Thanks @Meriam Guellil for sharing! I am just curious, wasn't the --preload thing broken until recently?
*Thread Reply:* always worked for me but I think it was only broken in one particular version and now they switched it to implement the new loading system (I haven't changed to that yet) but 🤷♀️:skintone2:
*Thread Reply:* according to their github it was fixed for v0.6 in October 2021 but not quite sure which version broke it. I install it through conda and I guess I missed it somehow
*Thread Reply:* As far as I know many people from different groups tried --preload and reported that it was not working but I suspect it might have something to do with your particular cluster environment
*Thread Reply:* either way it should be working now
*Thread Reply:* @Nikolay Oskolkov I have been using the --preload option on Kebnekaise and it works fine. Also on Kebnekaise we could preload the database into a cluster ramdisk making it possible to only use the same preloaded database for all the runs in the same slurm array of jobs. Gave the same results than without the --preload option on Uppmax. Nevertheless, I believe this trick is quite cluster specific. (Sorry guys those are just weird Swedish cluster names)
*Thread Reply:* I've heard of uppmax but Kebnekaise is a new one😅🤣 how do you even day that?!
*Thread Reply:* I just try to say it and probably fail every time, Swedes won't complain anyway 😅 Sadly that cluster won't be available at the end of December, I was happy there 🥹
*Thread Reply:* @Betsy Nelson is that a yes? We would love to have you on board again 🙂
*Thread Reply:* I haven't signed up yet, if the Netherlands would help?
*Thread Reply:* Do you have a spare 5 imnutes now?
*Thread Reply:* Or in the next 15?
*Thread Reply:* https://gather.town/app/PlXjb0deog0B4JCq/spaam-community
*Thread Reply:* I just signed up as a member last week (I’m US-based). Let me know if there is anything I can do to help!
*Thread Reply:* Thanks! Had a few people help me out, unfortunately for many countries paypal is a :poop_party:
*Thread Reply:* So we are looking for alternative solutions too now
Dear all, we are making a few large KrakenUniq databases and Bowtie2 indexes public:
```KrakenUniq database based on full NCBI NT: https://doi.org/10.17044/scilifelab.20205504
KrakenUniq database based on microbial part of NCBI NT: https://doi.org/10.17044/scilifelab.20518251
KrakenUniq database based on microbial part of NCBI RefSeq: https://doi.org/10.17044/scilifelab.21299541
Bowtie2 index for full NCBI NT database: https://doi.org/10.17044/scilifelab.21070063
Bowtie2 index for pathogenic microbial species of NCBI NT: https://doi.org/10.17044/scilifelab.21185887``` As you may know the new version of KrakenUniq allows running taxonomic classification in low-memory computer environments (in theory, even on a laptop) provided that a database is available. Further, Bowtie2 aligner can be used for following up (authentication, validation) KrakenUniq results. Bowtie2 is fast and quite memory-efficient, and one can use e.g. sam2lca from Maxime Borry and co https://www.theoj.org/joss-papers/joss.04360/10.21105.joss.04360.pdf to add an LCA on the top of Bowtie2 alignments. You can download the KrakenUniq databases and Bowtie2 indexes and use them for you research, we only kindly ask you to cite our work here https://www.biorxiv.org/content/10.1101/2022.10.03.510579v1. Please contact me if you discover any problems downloading or using the databases.
*Thread Reply:* Just a short comment. The NCBI NT is the one used by default by BLASTN. The Microbial NCBI NT includes: archaea, bacteria, viral, fungi, protozoa and parasitic worms (plus it also includes hg38 human references genome + a few complete eukaryotic reference genomes to be served as a decoy to attract potential eukaryotic contamination)
*Thread Reply:* Hey @Nikolay Oskolkov, I just wanted to clarify if the Microbial NCBI NT database is from all microbial genomes as per June 2020 or 2022? On figshare it says 2020 in the title but 2022 in the text. Also, thank you so much for making this available!!
*Thread Reply:* Hi @Meriam van Os the microbial NCBI NT if from June 2020. I have just checked the README.txt and it also correctly says "June 2020". Where did you see 2022?
*Thread Reply:* oh @Meriam van Os I have just found it! Indeed, in the short description for that database there was 2022 instead of 2020, sorry about this, I have just fixed it, and it should be updated soon. Anyway, it is the 2020!
*Thread Reply:* I was just trying to find in on my phone haha. Thanks for your quick reply Nikolay! I'll give it a try soon 😁
*Thread Reply:* I believe recentrifuge is supposed to be able to do this
*Thread Reply:* The Decontam R package wouldn’t necessarily remove reads per se. It would remove mapped reads to contaminants which may be helpful in some cases if you had cross contamination and your sample reads infiltrated your EBCs.
*Thread Reply:* Right, and for decontam you need additionally either [DNA] or negative controls.
*Thread Reply:* Interesting. We have been using v0.5.2 but haven't been running into any issues. Just so I understand, you are having trouble with malt-build and malt-run?
*Thread Reply:* @Åshild (Ash) we have also discovered lots of issues with the recent versions and therefore have been using 0.4.1 as the most stable version to our experience. However, this version also has bugs, a colleague of mine, Claudio Mirabello, has reported an issue here http://megan.cs.uni-tuebingen.de/t/malt-build-does-not-seem-assign-a-tax-id-to-some-references/1758
*Thread Reply:* @Sterling Wright Yes, I had issues with malt-build (it wasn’t functioning like v0.3.8 or v0.4.1), and I already knew about the LCA issue that Aida pointed out as well.
*Thread Reply:* @Nikolay Oskolkov Thanks for sharing. I didn’t know about the taxon ID issue
for the version 0.4.1 issue: http://megan.informatik.uni-tuebingen.de/t/unable-to-change-the-default-coverage-parameter-for-naive-lca-assignment-with-malt-v-0-4-1/2032
*Thread Reply:* https://www.protocols.io/view/ancient-dna-extraction-from-dental-calculus-bidyka7w
*Thread Reply:* @Ele and @Nasreen Broomand: I don't know if you got that in the zoom chat, but I'd love to help with this in a couple of months
*Thread Reply:* Lovely!!! We will be in touch Maria!
*Thread Reply:* It’d be great to have a platform that doesn’t erase messages, but I honestly hate that Discord doesn’t allow you to select which channels to be in 😑It means you get notifications for everyyyyy channel (you can mute but the highlighting for new messages never goes away since you cant actually leave it). I’ve never used Element, but the channels thing is what keeps me attached to Slack. Also replies don’t thread 😑
*Thread Reply:* Slack is the obvious choice for me too, the only downside is the disappearing messages. I’ve lost a couple messages where people gave me help that I wanted to keep referencing… I guess as it grows we could have a pinned post telling people how to use the slack, including “if someone helps you, save the message to your own notes”
*Thread Reply:* I tried Element a while back and it really doesn't compare to slack (of course that was before the 90-day message BS...). Might be worth piloting a few options to see what works; and worst case just stick with slack
*Thread Reply:* How many members are we currently? It looks like if we upgrade to Pro you will get back your messages from >90 days ago (which are only hidden, not deleted)
*Thread Reply:* That's the current stats
*Thread Reply:* Also just found out that Element is beta-testing replies in threads!!
*Thread Reply:* But do they support gifs?
*Thread Reply:* It looks like they have a giphy integration
*Thread Reply:* I think only if you host your own server though 😕
*Thread Reply:* From the one I created for the Rchaeology group (not self-hosted)
*Thread Reply:* @Olivia It's possible to select which channel you wish to receive notifications for in Discord -- right click on the channel and select 'Mute Channel' or 'Notification Settings'
*Thread Reply:* Not being able to see messages past 90 days is a massive hindrance to sharing information/knowledge IMO. Discord is everything that Slack is + more, and it's free.
*Thread Reply:* @Raphael Eisenhofer that's a fair point, althoug hthe entire opt-in by default is a bit shit (IMO), I'm also concerned that discord could also start locking down in the future (and we would have to go through the whole hoopla again))
*Thread Reply:* Which is making me leaning towards just trying to get some funding anyway...
*Thread Reply:* I'm: @jfy133@genomic.social
*Thread Reply:* @James Fellows Yates could you please explain me why people are moving to Mastodon? What is wrong with Twitter?
*Thread Reply:* Elon Musk has fired half the employees, of the remainder half (or more) have quit. Also he plans to monetise it like crazy to make up the money he's all lost, and he's essentially allowing more abuse and shit on it in the name of 'free speech'
*Thread Reply:* Aha, ok, I am not up to date on this topic 🙂 thank you for the explanation!
*Thread Reply:* A quick skim here also explains why people are moving to mastodon: https://www.washingtonpost.com/politics/2022/11/12/musk-is-wrecking-speech-moderation-twitter-theres-an-alternative/
*Thread Reply:* (basically better networking on specific topics, better moderation)
*Thread Reply:* The timeline here also describes worrying behaviour: https://www.bbc.com/news/technology-63675849
*Thread Reply:* Such as the banning of people joking about musk
*Thread Reply:* Free Speech! (just not about me...)
*Thread Reply:* @Gunnar Neumann@ecoevo.social
*Thread Reply:* I haven’t joined Mastodon yet, but will soon! I checked Twitter a couple times in the past two days and I experienced some performance issues already, like replies to tweets not loading etc.(even though my internet is fine)
*Thread Reply:* sorry guys I am a bit behind on this topic. I would also like to join but haven’t done a profile yet. I will soon!
*Thread Reply:* For those who are joining/already joined don't forget ot add yourself here: https://jfy133.github.io/Mastodon-Palaeogenomicists
*Thread Reply:* Hi Meriam. I think I'm seeing the same in a hyb-capture run I recently performed. I haven't figured out what this may be but looking at the sequencing data, the vast majority is off-target. Please let me know if you find out what's causing this 😬
*Thread Reply:* Would you mind sharing your BioAnalyzer run profile? It might still be “bubbles” but that will be very clearly visible on the plots
*Thread Reply:* That's what they look like!
*Thread Reply:* You are absolutely right. Doesn’t look like bubbles at all. How long are your adapters and are your fragments ligated to adapters prior to capture? Asking, just because a fragment with adapters of the expected size of 100bp is rather short
*Thread Reply:* I'm not sure exactly, but in previous batches we have fragments of about 160-170 bp in total on the bioanalyzer for an average size of about 60 bp of actual aDNA sequence. But these are 260, so another additional 100 bp...
Hello @channel for those of you who are interested this is a reminder that tomorrow at 5pm CET we are having our first SPAAMtisch meeting! Chosen topic: what should SPAAMtisch be for you? If you have somehow missed it, you are still on time to join the #spaamtisch channel and feel free to be at the first meeting. Just to refresh the concept #spaamtisch will hold regular meetings for people who want to discuss some topics of interest chosen by the community and in an informal way! No knowledge or preparation required! All stress free 😉 The link to join below! https://gather.town/app/PlXjb0deog0B4JCq/spaam-community
*Thread Reply:* Does sedaDNA have any financial support or anything?
*Thread Reply:* No we don't have any financial support.
*Thread Reply:* Im going to message you 😉
*Thread Reply:* do you already have a date in mind?
*Thread Reply:* Not yet, but around the same time - July/August (probably late/early)
*Thread Reply:* Is it online, or in person? i.e., do instructors have to be in Leipzig?
*Thread Reply:* Then I'd be happy to give a lecture, if you'd like! I could teach a number of the classes from last year - we can chat.
*Thread Reply:* Thanks! Yes, let's talk in real time
*Thread Reply:* IMPORTANT: fill out the rota of topics if you want to propose something to discuss in coming meetings 🙂 (doc pinned in channel)
*Thread Reply:* Hey Maria, are these sessions recorded? I'd be very keen to watch them if there are talks/workshops etc. I'm in an awkward time zone 12 hours ahead of you 😬
*Thread Reply:* Hi @Meriam van Os nope atm we aren't recording them. However, we do take notes so you can read everything that has been discussed so far in the document pinned in the #spaamtisch channel.
*Thread Reply:* Don't forget to tweet about it!
*Thread Reply:* Hybrid event is not an option you consider?
*Thread Reply:* Hi Jasmin, we were more thinking of a discussion based format for the in-person meeting (maybe some “round tables”). We might have a camera set up but don’t know for sure yet.
Hello @channel our next two #spaamtisch meetings will be in different formats. I have invited two authors presenting their published or nearly published recent research work. For our first #spaamtisch of this format we’ll have @Camila Duitama presenting on the 21st of March at 5-6pm CET. Camila will present her work on:
decOM: Similarity-based microbial source tracking of ancient oral samples using k-mer-based methods https://www.biorxiv.org/content/10.1101/2023.01.26.525439v1.full
Everybody can participate to this meeting. However, as per community vote earlier this month, PIs will be allowed to ask one question in order to give the opportunity to young researchers and students to be more involved. So read up and prepare your questions! 🙂
*Thread Reply:* > "Abstract submitted successfully" :toad_scream:
*Thread Reply:* just to clarify -- can we still submit on the 15th? if so, when is the cutoff time?
*Thread Reply:* At 23.59 CET on the 15th March.
*Thread Reply:* and should we indicate anywhere that it could be ideally a talk but also considered for a poster?
*Thread Reply:* see post in the main chat 🙂
@channel Also, you could send an abstract to the SMBE too! Especially to this symposium, "Host-pathogen co-evolutionary dynamics through the lens of paleogenomics." https://www.smbe2023.org/abstractsubmission. The deadline for abstract submission will be on the 15th of March too!! 🦠
*Thread Reply:* Wait isn't that the ides of march too 😶🌫️
*Thread Reply:* https://www.pantone.com/color-of-the-year/2023 close enough? 👀
*Thread Reply:* quick q - what's the connection between SPAAM and ISBA, is there a meeting coinciding with the conference in September? thanks!
*Thread Reply:* Hi, Yes tentatively a meeting a day before ISBA10 is planned in Tartu. It is currently still in planning. But you can check the general chat for a poll regarding preference we sent out a couple of weeks ago.
*Thread Reply:* I'm wondering if there could be a video recording, because it will be already midnight in China at the time of the meeting.🫣
*Thread Reply:* Hi @Wenqin Yu btw 😉 👋
*Thread Reply:* Hi @Wenqin Yu yes there will be a video recording that I will upload sometime soon on the youtube channel of spaam 🙂
*Thread Reply:* Currently not, sorry. At least not from us. I would love to be able to run it in different time zones, and I've constructed the material so other SPAAMers/people can run the same course elsewhere.
I'm happy to act as a consultant if you can get enough teachers in your timezone
Note all the material and recordings go online under a creative commons license so you can also follow outside of the summer school itself
*Thread Reply:* Thanks, I'll probably follow along with the recordings, then. Hopefully there will be momentum to teach it live in other time zones soon!
*Thread Reply:* The more people ask loudly the more likely it will happen! ;)
*Thread Reply:* Is registration for ISBA10 open yet? There doesn't seem to be any links on the website.
*Thread Reply:* It will be open soon, there was some delay because of the abstract extensions and website developer. I will announce it here once it is live but it should be soon
Dear @channel save the date! As anticipated our next #spaamtisch meeting will be in seminar format and it will be done on the 18th of April 2023 at 5-6 pm CET via Teams. Our next speaker will be @Andrea quagliariello who will present his recent work on ancient oral microbiome. More info below.
https://www.nature.com/articles/s41467-022-34416-0
Dear @channel don’t forget tomorrow the 18th at 5-6pm CET our second seminar for SPAAMtisch where @Andrea quagliariello will present their recent work!
Find below the link to the Teams meeting.
You do not need a Teams account or app installed on your device if you just choose the option “Join from web” on Google Chrome as your web browser. See you tomorrow!!!
Microsoft Teams meeting
Join on your computer, mobile app or room device
*Thread Reply:* Thank you so much @Maria Lopopolo for arranging the SPAAMtisch seminars! Is there any chance that they start a bit earlier during the day? I typically have family commitments at 5-6 pm and miss the talks every time 😞 I understand that times won't be optimal for everyone in any case, but perhaps alternating would be an option?
*Thread Reply:* Hi Nikolay, I am sorry to hear that 😞 . I can try to do a poll with some options to see how to better accommodate the majority. But the the main reasons we do that time are 1. Because many people who aren't at CET, the earlier we do it the less would be involved and 2. Even the people at CET often prefer to attend/be available for seminars after "official" working hours. However, for those that you have missed, I am recording the talks and they will be uploaded on the YouTube channel in the next few days. Nevertheless, I'll try to see what I can do for next month ;)
*Thread Reply:* Cool, I did not know about the recordings, would be glad to watch some 🙂
*Thread Reply:* Yes and I take the opportunity to thank @irinavelsko and @Miriam Bravo who helped me moderating the two last sessions of the seminar format #spaamtisch. I'd like also to remind that these meetings will also keep alternating with the "regulars' table" more informal format where we discuss a community chosen topics :)
Hello Everyone!
We are thrilled to announce that registration for the first in-person SPAAM meeting since the pandemic is beginning, SPAAM5! This year we are holding a one-day only in-person meeting on September 12th, 2023 in Tartu, Estonia. We are taking advantage of this year’s ISBA meeting in the same location to meet in person the day before it starts. As attendance is limited, we will give priority to early career researchers. This meeting will feature networking, flash talks, and more! But if you can’t make it, don’t worry, another online-only meeting will be held in November to make sure as many people as possible can participate in SPAAM5. Additionally, anyone who cannot present in person during the Tartu meetings this September will be prioritized for online-only presentations in November.
To register for the in-person event, please fill out this form by June 16: https://forms.gle/nJUMGzTmH6Knuy7R9.
For selected participants, a 15 Euro registration fee will be collected prior to the start of the meeting and will cover lunch, coffee and refreshments. Registration waivers are available upon request: please contact spaam.events@gmail.com.
Looking forward to finally meeting in person,
The SPAAM5 Organizers
*Thread Reply:* Hey @Zoé Pochon when will we know if we have been accepted/there is space for us?
*Thread Reply:* We've now got ISBA acceptance emails and will need to start booking stuff already
*Thread Reply:* (so need to know whether can factor in a day early or not)
*Thread Reply:* Good question, let me check with the others. For the moment there is only like 12 people registered so I hope we won't have to do a selection
*Thread Reply:* Might be worth sending Reminders everywhere now acceptance emails are out and they have a better idea if thy are going or not :)
*Thread Reply:* Yes! I suggested it to the others, we will do that as soon as possible 😉. Thanks James 😊
*Thread Reply:* You could also maybe ask ISNA people to mention it in one of their emails
*Thread Reply:* You could also maybe ask ISNA people to mention it in one of their emails
@channel you're getting an extra reminder ;()
Registrations for the SPAAM ancient metagenomics summer school is closing NEXT FRIDAY! Please share the word and your colleagues/students :)
https://spaam-community.slack.com/archives/CPYE64ZC6/p1680521393090799
@channel Reminder to register now for SPAAM5 - there are still free spots for the SPAAM meeting in Tartu, Sep 12 (one day before ISBA starts). For questions contact spaam.events@gmail.com or the organisers: @Alina Hiss @Megan Michel @Sierra Blunt @Olivia @Zoé Pochon @Alice Lee @Meriam Guellil https://spaam-community.slack.com/archives/CPYE64ZC6/p1682519247837749
}
Very last reminder for the summer school applications! The Submission form closes tonight!
https://spaam-community.slack.com/archives/CPYE64ZC6/p1680521393090799
*Thread Reply:* @James Fellows Yates I do not recall (and can’t find) if you sent any email via SPAAM mailing list that I could share with my colleagues in case somebody wants to register last minute?
*Thread Reply:* Nevermind, I can just copy the text from the announcement above and send as a separate email to my colleagues 🙂
*Thread Reply:* I sent multiple to the SpAAm mailimh list
*Thread Reply:* Are you not on it
*Thread Reply:* Oh, I think I found it, sorry! 🙂 I checked thus morning on my scilifelab address but the one included in SAAM mailing list is probably my Lund University email 🙂 Sorry for my confusion!
*Thread Reply:* You can always sign up with the other is your wish
*Thread Reply:* And we can cancel the lund
*Thread Reply:* No worries, I use both of them. I was just for some reason sure this morning that SPAAM is using my scilifelab email 🙂
*Thread Reply:* Hi there! Wondering if there was any news about the summer school for those of us who applied? 😬 Colleagues and I haven’t heard back and wondering if no news is bad news haha. Thank you!
Hello @channel today there is our #spaamtisch meeting at 5-6 pm CET! We will discuss together about:
- Functional analyses on pathogens or microbial communities
- If we have time: Taxonomic classifiers! We will gather in gather.town (see link below) See you soon!! ☺️ ☺️
https://gather.town/app/PlXjb0deog0B4JCq/spaam-community
The SPAAM twitter account has more than 500 followers now. :partyparrot: https://twitter.com/spaam_community
*Thread Reply:* I can ask back channels for you for an informal answer
*Thread Reply:* Also I'm sure members of the ISBA conf committee are also watching 😉
*Thread Reply:* we are 😅 but I am sadly also not knowledgeable about this (I have asked a bunch of times the last couple of months but never gotten an actual reply) but I have reached out yesterday again. If I hear back I will let you guys know.
@channel Reminder to register for SPAAM5 until this Friday 16th of June - the SPAAM meeting will take place in Tartu, Sep 12 (one day before ISBA starts). For questions contact spaam.events@gmail.com or the organisers: @Alina Hiss @Megan Michel @Sierra Blunt @Olivia @Zoé Pochon @Alice Lee @Meriam Guellil https://spaam-community.slack.com/archives/CPYE64ZC6/p1682519247837749
Today is your last chance to register to the SPAAM event, which will take place in Tartu, one day before ISBA, on September 12th! Looking forward to seeing you there 😊!
*Thread Reply:* I'm planning to exploit some friends there to go to somewhere instead too 😬
*Thread Reply:* I am free to join you, too 😁
*Thread Reply:* I just registered with Nils (from HR) paying the conference fee. He is asking if you @James Fellows Yates want to register next week Wednesday as well or did you pay yourself already?
*Thread Reply:* I've paid already myself
*Thread Reply:* I was told they only do reimbursements not direct payments on your behalf
*Thread Reply:* From Nils' question I assume that @Maxime Borry still hasn't filed the Dienstreiseantrag? 😬 PM me if you need help from someone physically at HKI
*Thread Reply:* They pay on our behalf ONLY conference fees, no travel expenses/hotels beforehand.
*Thread Reply:* Wewll it would be nice if they documented this but oh well
*Thread Reply:* @Jasmin Frangenberg no, i haven't done it yet
*Thread Reply:* hello! Is there a recording of a seminar for the pacific time zone folks? cheers : )
*Thread Reply:* We did record it so will go up soon!
*Thread Reply:* Please contact the organising committee at the email address provided on the website: Organising committee: isba2023@ut.ee
*Thread Reply:* Not sure about the answer though since I believe this would be the first (although maybe not the last) case of this sort. This will depend on the Estonian side.
*Thread Reply:* But hopefully it can be sorted. I have given them a heads up.
*Thread Reply:* I was just told a refund will be available but please get in contact with the email admin
*Thread Reply:* Yes they just told me the same thing. Thanks again
🚨Hello @channel🚨 📣Check out the FIRST SPAAM :spaam: NEWSLETTER!! 📣 :headbangingparrot: 🚨We are thrilled to bring you an exciting update on the community, upcoming events, current and new initiatives, recent publications from the past three months, and available job positions. 🚨 We will post the next one in three months! :spaam::catjam:
*Thread Reply:* Sooooooo......
@channel in case anyone is interested to join, we are offering a course this fall in ancient environmental genomics: https://twitter.com/miwipe81/status/1671094458039820289?s=46&t=gwKWZJ5qldtF98LPMY9EQ|https://twitter.com/miwipe81/status/1671094458039820289?s=46&t=gwKWZJ5qldtF98LPMY9EQ
*Thread Reply:* Here is a weird contribution, that took me a while to find out ! Answer tomorrow evening 😉
*Thread Reply:* Yes please 😄
*Thread Reply:* Ligation biases to barcoded adapters (double-stranded library).
*Thread Reply:* Ooooh! Is that a published sample? And can you write a short blurb
*Thread Reply:* Yes, that's from https://doi.org/10.1093/molbev/msac263 but I don't think the plot itself is included in the publication. Similar (possibly more obvious) plots are included in the supp mat here (https://doi.org/10.1093/molbev/msaa135, Fig. S11) and the explanation for the pattern is in the legend and the supp methods text. "During this investigation, we observed unusual damage patterns in several of our samples – rather than the expected incremental rise in deamination towards read ends, several samples showed a drop in the frequency of C-to-T substitutions from the penultimate base to the terminal base (e.g. comparison of damage patterns in Ua9 MAGs compared to Ua14 in Supplementary Fig. S11). It has been suggested previously that barcodes with a terminal G or C have reduced ligation efficiency to damaged cytosines at 5’ ends of reads (Rohland et al. 2015). We therefore examined damage profiles for 14 most abundant bacterial taxa in the post-filtering dataset (Supplementary Table S6), using mapDamage as part of the EAGER pipeline v1.92.37 (Peltzer et al. 2016). We only considered cases with more than 10000 reads mapping to a taxon reference genome in a given sample in order to have enough coverage to discern a clear pattern above the background noise. We found that samples containing barcodes with a terminal G or C were more likely to show the unusual pattern (χ2 = 31.11, df = 1, p-value < 0.0001) (Supplementary Table S13)."
*Thread Reply:* I can try and get the data from Ena and try to recreate
*Thread Reply:* Unless you have the mapDamage files still
*Thread Reply:* Was trying to dig them up and cannot find them. Maybe @Jaelle Brealey @Jaelle Brealey (not sure if she's active here and under which of the two handles) could be of help
*Thread Reply:* Will try to reach her elsewhere
*Thread Reply:* I should be able to pull up the mapDamage files somewhere, I'll dig through my old data folders.
*Thread Reply:* For the one I posted above, it was soft clipping because of using bowtie2 in end-to-end alignment mode 😉
*Thread Reply:* @Maxime Borry could you supply me a bam file so I could make a mapDamage/DamageProfiler plot? (alternatively the pyDamage raw files so I can partly recreate your plot)
Hi all, The SPAAM community has a Mastodon account now! :partyparrot: You can follow it here: https://genomic.social/@spaam_community
FYI, as we are currently in a 'free trial' of slack, I'm making an export of all our slack data (that we can), that way we can review old messages if you ever need!
I will keep a back up as will the steering commitee 🙂
Hi everyone!!! As previously mentioned, we prepared a survey for you to fill out, so that we can collect feedbacks and opinions on #spaamtisch! We will take answers till the 31st of August. We can’t wait to see your feedbacks, in order to make the event a better experience for everyone!!
And, if you don't know what #spaamtisch is...go check it out in the slack channel!:catjam: Cheers :spaamtisch::spaamtisch:
https://forms.gle/hqJkAkgP3duyRZAd9
What, this shirt ;)?
(Don't let the model put you off, the shirt is pretty good! Note they run on the slightly larger/longer side, at least medium)
*Thread Reply:* Thanks for sharing that info 🤏
*Thread Reply:* Is it still possible to order? I tried and amazon said that it has been already sold 😞
*Thread Reply:* Strange... should be on demand AFAIK?
*Thread Reply:* @Kadir Toykan Özdoğan maybe will need to investigate
*Thread Reply:* This is what I get. Hmm, perhaps it does not explicitly say “sold” but something did not work
*Thread Reply:* Isn't the adress the problem there?
*Thread Reply:* Oh, it might be the location.
*Thread Reply:* I put my Swedish address 🤔
*Thread Reply:* It is possible that they do not send it to Sweden, although would be strange.
*Thread Reply:* Maybe they do not like ä, å and ö Swedish letters 🙂 I will try again
*Thread Reply:* I can’t get one to ship to the UK either 🥲
*Thread Reply:* @Gunnar Neumann maybe you should come up with a procedure/instructions how others can order via you?
*Thread Reply:* This is easier to solve @Kelly Blevins. I can make them available for the Amazon UK, should just take a couple of hours.
*Thread Reply:* Is that beard for sale also? 👀
*Thread Reply:* assuming it wont be a huge mass of people having issues, people can just contact me directly and we discuss deatails. I would put the order at the end of the month, September 30th
*Thread Reply:* UK links: only back print https://www.amazon.co.uk/dp/B0CGJ4ZBLM https://www.amazon.co.uk/dp/B0CGJ65RX1
back&front https://www.amazon.co.uk/dp/B0CGJ6NFK4 https://www.amazon.co.uk/dp/B0CGJDXN27
*Thread Reply:* It doesn't work to order it to Sweden for me either
*Thread Reply:* Maybe for Sweden people you can send the money to Gunnar to order for you then?
*Thread Reply:* Would that be okay @Gunnar Neumann? I can transfer you the money (Revolut, bank transfer... )
*Thread Reply:* Of course @Zoé Pochon just let me know what size, colour , print (back only or back/front) Maybe you can just pay in cash in Tartu
*Thread Reply:* @Gunnar Neumann The Amazon page says they are all out of stock. Do you have suggestions?
*Thread Reply:* I’d like to order a men’s large navy shirt
*Thread Reply:* @Tina Warinner looks fine here when i just checked.. i will order one for you then, too. Will you be in Leipzig before? otherwise i bring it to Tartu.
*Thread Reply:* @Gunnar Neumann I have the same question. If there are some left, I’d like to order a men’s medium black shirt.
*Thread Reply:* Oh, wait I fixed it. My shipping address was set to the US and it didn’t work, but now that I changed it to Germany it works
*Thread Reply:* I’ll go ahead and order it online to deliver to the institute. Thanks @Gunnar Neumann!
*Thread Reply:* ok.. i take you off the list then.
*Thread Reply:* sure, @Sarah Johnson i will order one for you. they will be printed on demand/order.. so there are as many “left” as we want. 😉
*Thread Reply:* i assume you want print on back and front?
*Thread Reply:* @Gunnar Neumann I see! That’s great thank you so much. Yes I would like it printed on both back and front. Let me know how I can send you money. I’ll be in Tartu beginning the 12th.
*Thread Reply:* you can pay me in cash on site.. otherwise we figure something out when there..
*Thread Reply:* Thanks a lot @Gunnar Neumann for arranging it!
👀 anyone gonna be in Tartu next Monday afternoon and want to do this adventure park with me? http://www.tartuseikluspark.ee/ Nothing puts pre-conference nerves in perspective like dangling from a rope ladder 12m off the ground 😃
*Thread Reply:* It’s really close to the conference venue, so depending on when SPAAM wraps up we could potentially go on Tuesday if that works better for people
*Thread Reply:* I will arrive in Tartu on Friday, but I can't join any "sports" atm. Happy to join you for a coffee or something else on Monday afternoon/evening.
*Thread Reply:* 🥺 I'd love to, but will prbly not arrive before 7pm. But let me know your experience! Because I will have plenty of time after the conferences (6 days vacation).
*Thread Reply:* @Tina Saupe I'll be arriving in Tartu around 17 (they booked me a later train than expected). A coffee sounds great to me since as it turns out I may be getting in too late for the adventure park. (Sorry @Kelly Blevins 🙁)
*Thread Reply:* No worries! My train gets in around 3. I will go adventure parking after that. But perhaps we could meet up for drinks/coffee later this evening?
*Thread Reply:* Coffee/drinks sounds fabulous!
*Thread Reply:* I’m https://maps.app.goo.gl/XXuXDTD3wBSXc5WR6?g_st=ic if anyone wants to join 🍻
*Thread Reply:* Well that's a given, but I meant more proper publications
*Thread Reply:* https://pubmed.ncbi.nlm.nih.gov/28460196/
*Thread Reply:* https://www.nature.com/articles/s41576-019-0119-1
*Thread Reply:* https://www.nature.com/articles/s43586-020-00011-0
*Thread Reply:* On a roll @Camila Duitama :catjam:
*Thread Reply:* I guess I have reading for the plane on the way to SPAAM-5
*Thread Reply:* Let us know your favourite after @Dawn lewis!
*Thread Reply:* Two person consensus from myself and Irina: to answer your questions in order:
- "studies that use samples with DNA from many organisms / taxonomic groups." Not necessarily
- "Metagenomics is the study of communities of organisms via DNA": Yes
- "Do Metagenomics studies have to study contemporary organisms": No
- "Is a study that uses metagenomic samples (i.e. sediments), but focuses only on one species / taxa within those samples still a metagenomic study?": No Longer form:
The main issue here for you is that all 'ancient' studies are interestingly metagenomic. They always have a community of organisms ancient/modern. In most cases all ancient DNA studies will use metagenomic 'approaches' or consider concepts that are a strong focus of metagenomics (e.g., contamination from other organisms). A metagenomics study does not have to be studying purely contemporary organisms - you also have necrobiome studies, sediment studies over a time transect is still metagenomics, if you are aiming to look at the whole or large fraction of the community of organism.
Specifically for 4: these studies indeed apply a little bit of metagenomic approaches or techniques initially, however the end goal is ultimately indeed not 'metagenomics' given the strong focus on single taxa.
*Thread Reply:* In our opinion
*Thread Reply:* This is really great, thank you! It helps to clarify my thinking a lot. Essential, clarifying between metagenomic data/approaches and metagenomic STUDIES.
*Thread Reply:* Agree with James and Irina.
To add re. definition of metagenomics: I think both are correct — the first for metagenomics methods, the second for metagenomics analysis/interpretation. I would add ‘genome-wide DNA’ though (to separate from metabarcoding).
As a [descriptor] study is based on the approach used for analysis/interpretation, community-reconstruction sediment and microbiome studies can be called metagenomic. IMO.
*Thread Reply:* Also very excited for whatever Pete is typing 🙂
*Thread Reply:* >This is really great, thank you! It helps to clarify my thinking a lot. Essential, clarifying between metagenomic data/approaches and metagenomic STUDIES.
This is what I should have said back in that late tired evening ;)
*Thread Reply:* Ah, so you would say that metabarcoding studies are not metagenomic?
*Thread Reply:* I would argue not. They share the ‘meta’ aspect, but they are not ‘genomic’
*Thread Reply:* > Ah, so you would say that metabarcoding studies are not metagenomic?
*Thread Reply:* Absolutely not
*Thread Reply:* They are Metataxonomic
*Thread Reply:* Wait ignore the absolutely before I put my foot in it
*Thread Reply:* metataxonomic, I like that
*Thread Reply:* That's a true term!
*Thread Reply:* I promise not to screenshot any more of your replies, James!
*Thread Reply:* but surely metagenomics is metataxonomic, too?
*Thread Reply:* More recent papers describe it
*Thread Reply:* > but surely metagenomics is metataxonomic, too? > Yes, it's just not bidirectional
*Thread Reply:* > I promise not to screenshot any more of your replies, James! > I dunno, maybe we can make it a tradition ;)
*Thread Reply:* Ok, followup question: Are metagenomic studies primarily interested in taxonomic abundances and/or presence/absence?
*Thread Reply:* Not anymore. It's often a first component of a metagenomic study, but it's less and less the sole focus
*Thread Reply:* Again: two person consensus
*Thread Reply:* “Are metagenomic studies primarily interested in taxonomic abundances and/or presence/absence?”
Depends on the question (and the study system). SedaDNA still uses the latter primarily (due to biases associated with the former).
*Thread Reply:* Hey @Benjamin Vernot, Pete, Irina and I are coauthors of your presentation now right?
*Thread Reply:* at this point, yes!
*Thread Reply:* One species, then no. Entire communities: yes.
If more than one species but not a community (the three refs. you list): then good question! I guess pathogen studies also fall within this category, too…
*Thread Reply:* I just chatted with the two pathogens PIs at our institute, and they both said that they don't think of what they do as metagenomics. That they drill into the data too much, to get at the 1-2 species they're really interested in.
*Thread Reply:* Yeah, as in the other thread: apply metagenomic approaches at the intital stages and then genomics afterwards
RE
https://spaam-community.slack.com/archives/CPYE64ZC6/p1693033331765469
We unfortunately were unable to find a place that could take everyone sorry 😞 but if you want suggests for restuarnts, I'm sure @Meriam Guellil or @Marcel Keller or @Biancamaria Bonucci can suggest places (or see the SPAAM5 whatsapp chat for recommencations from @Biancamaria Bonucci)
*Thread Reply:* you're awesome
*Thread Reply:* Dolce vita is closed this week!
*Thread Reply:* Thanks! This might actually get me through multiple PCAs 🙌:skintone2:
*Thread Reply:* I just added a bunch of kinship ones too !
*Thread Reply:* I only got 2 ;)
*Thread Reply:* So good job 😂
*Thread Reply:* Hah no, I meant on the bingo cards :)
*Thread Reply:* That's what I mean! Oh wait, you think getting a bingo is good?!
*Thread Reply:* gotta keep my popgen cred!
*Thread Reply:* Many thanks everyone! The beers are on me (in 5 years) 😊
*Thread Reply:* I don't want it if it's not yelled at! 😁😁😁:spaamtisch:
*Thread Reply:* Omg @James Fellows Yates I just learned the meat thing of the name spaam 🤣 this is brilliant 👏 👌 and huge thanks to you for creating this amazing platform ✨
*Thread Reply:* I think we could manage to make it fall under this theme "Archaeological Sciences, Humanities and the Digital era: Bridging the Gaps"
*Thread Reply:* Hey Ian, Kadir and I will start the initiative #MetagenomicsMondays where we will tweet papers from the microbial field, old, new and sci-com.
*Thread Reply:* • select limited number of representative genomes for each taxa • if using kraken2/krakenUniq, I would lower the kmer-size to 32/30 to build the db, of course it will increase the chance to get FP on further metagenomic classification
*Thread Reply:* https://github.com/msabrysarhan/taxonize_genbank We wrote this python package to filter the NCBI non-redundant protein or nucleotide databases based on taxonomy so we can confine the search for specific taxa, when using diamond for example (This is in case of dietary analysis). It saves a lot of time 🙂
*Thread Reply:* this is our solution to build our DBs:
*Thread Reply:* this feels like an obvious one, but someone has to mention it! https://www.annualreviews.org/doi/abs/10.1146/annurev-genom-091416-035526?urlver=Z39.88-2003&rfrid=ori:rid:crossref.org&rfrdat=crpub%20%200pubmed|https://www.annualreviews.org/doi/abs/10.1146/annurev-genom-091416-035526?urlver=Z39.8[…]03&rfrid=ori:rid:crossref.org&rfrdat=crpub%20%200pubmed
*Thread Reply:* Of course! Thanks for tossing it out there 🙂 also curating favorite papers involving shotgun seq to have them read occasionally as the semester goes on
*Thread Reply:* Hmmmmm “ancient metagenomics bibliography” seems like a great blog post … I will keep thinking about papers and also keep an eye on this thread!
*Thread Reply:* I think I had a thread of this similar thing to
*Thread Reply:* Maybe more options there too!
*Thread Reply:* These 2 papers may also help.https://pubmed.ncbi.nlm.nih.gov/25487328/,https://pubmed.ncbi.nlm.nih.gov/31638147/
*Thread Reply:* Thank you all for this! This is great.
*Thread Reply:* Awesome thank you Miriam! Just wanted to mention there is an issue with the PAASTA twitter link - it wants to go to @peaas_community instead of @paastacommunity
Can I also selfishly add my own publication to the list? Only if you think it’s appropriate of course! https://onlinelibrary.wiley.com/doi/full/10.1111/1755-0998.13835
*Thread Reply:* Hello Dawn! Thank you for the correction and sharing your paper !! I’ll update the newsletter accordingly! 🙂
Dear @channel we, the spaam community media team, would like to invite you all to help us with the #MetagenomicsMonday initiative. Therefore, we kindly ask you to fill out the form below if you felt particularly inspired by a paper (e.g. a paper that for you was very important in defining your research field) or you think a paper is a milestone for ancient metagenomics, pathogens, sedaDNA, and ancient eDNA. We appreciate everyone for their help!
https://forms.gle/pKVhAeRJCCrQYFh16
Many thanks Maria and @Kadir Toykan Özdoğan
Form is pinned in the channel
*Thread Reply:* Hello, since I recently started my PhD, is it possible to attend without submitting an abstract?
*Thread Reply:* Yes we will open the registration later on. But we need some abstracts first for it to happen! So far, we're still waiting 😅🙏
*Thread Reply:* I've got some new sedaDNA work (modern!) that I just got data on (time series, MAGs, etc), but want to leave space for more on topic things. I'm going to submit an abstract, and would love to attend, but feel free to disregard if there's more relevant topics!
*Thread Reply:* Dear SPAAM organizers, please note that it says "SPAAM5" everywhere in the registration / abstract submission form instead of "SPAAM6" 🙂
*Thread Reply:* Do you mean the online meeting in January? That still belongs to SPAAM5 😉
*Thread Reply:* Aha, I mixed them up, now I see
*Thread Reply:* Thanks for sharing that @Barbara! Ngl the link confused me a lot at first 🤣
*Thread Reply:* Congratulations, @Miriam Bravo !!!
*Thread Reply:* will todays spaamtisch be recorded?
@channel we heard you! Please wait for news in 2024 👀 The format changes and so does the date. :meow_party:
}
Dear @channel 🚨EAA 2024 Calls for Abstracts OPEN NOW! Showcase your groundbreaking work, join our session “Building bridges: An open forum for Archaeology and Metagenomics” where experts from Archaeology and Metagenomics can unite to showcase groundbreaking projects! How : Tandem or solo presentations ⏰Abstracts due Feb 8th (oral) or Apr 8th (poster) 💻 Can’t make it to Rome? No worries! EAA offers online participation. 👉 Submit at submissions.e-a-a.org/eaa2024 with session number 854 More info https://www.e-a-a.org/EAA2024 #EAA2024
Join us in Rome for the EAA 2024 session #704 on ancient pathogens! 🦠Title: Bioarchaeology of Ancient Pathogens 🇮🇹🍝Where: In Rome! 📆When: 28-31 August 2024 ⏰Abstracts due by February 8th!
Interested in the impact of ancient pathogens on human populations, their domesticated animals, and crops? 🐐🚶🌽 Please submit an abstract in our session https://submissions.e-a-a.org/eaa2024/ Feel free to reach out to us, @Zoé Pochon, @Louis L'Hôte, @Rémi Barbieri, Shevan Wilkin @Kerttu Majander! @channel
Hello @channel
Abstracts are open for the EAA in 2024. If you're into old poop, we have the session for you! 💩
Session 1061: Appreciating the Archaeological Value of Preserved Faeces Using Multifaceted Methods
For more info, including the full session description, please see the attached flyer and let me know if you have any questions.
It would be great to see some SPAAMers there, so @ your fave coprolite / palaeofaeces / archaeological dung folks... Oh and it's in Rome ☀️
*Thread Reply:* Hello, I'm wondering what is the poster presentation DL? On the website the poster presentation deadline is 8th of April https://www.e-a-a.org/EAA2024/GeneralInfo.aspx?WebsiteKey=20b5538d-68f8-4056-9596-1ae1ce0ead47&hkey=d1efbf02-cbd8-4e90-87d9-3ebffb323fc5&NewContentCollectionOrganizerCommon=2#NewContentCollectionOrganizerCommon|https://www.e-a-a.org/EAA2024/GeneralInfo.aspx?WebsiteKey=20b5538d-68f8-4056-9596-[…]-4e90-87d9-3ebffb323fc5&New_ContentCollectionOrganizerCommon=2
Hello I would like to invite you to SMBE-July 7-11 2024 in Puerto Vallarta Mexico:meow_party: It will be a nice a opportunity to share and see each other in person. My colleague Sur Paredes and me (Barbara Moguel) organized the session "Molecular evolution through metagenomics" (https://smbe2024.org/) and our confirmed invited speakers are Nandita Garud (UCLA), and Gabriela Olmedo (Cinvestav). Abstracts are going to be due sometime in February.
Below I copy the description of the symposium which will be published in the SMBE 2024 meeting website. I hope you consider attending:
“The ecosystems across the globe are undergoing significant transformations, underscoring the imperative need to comprehend their eco-evolutionary mechanisms. Until relatively recently, most of the work on molecular evolution focused on the analysis of single species genomes. Recently, metagenomics has emerged as a valuable approach to ask global questions about biodiversity, ecology and evolution at the community level. With metagenomics, we can ask questions about comparative micro- and macro evolution, within and between environments, as well as removing the limits on difficult to culture organisms.
This session offers a unique opportunity to showcase the extensive and consequential methods and applications, both theoretical and experimental, that harness metagenomic data to ask questions about molecular evolution within diverse ecosystems. These ecosystems encompass animal and plant bodies, but also extreme natural habitats, historical landscapes, areas endangered by anthropogenic activities, and more. This symposium will highlight contributions that go beyond the acquisition of taxonomic and functional profiles, and that instead aim to disentangle the mechanistic details of the evolutionary process, focusing either on single species or community assemblies. This symposium aims to highlight the breadth of biodiversity that can be interrogated through metagenomics, which include both the complete extant tree of life, as well as ancient biodiversity which is increasingly important to comprehend the threats of climate change. This symposium will serve as a platform for sharing cutting-edge research, fostering collaboration, and advancing our comprehension of the molecular underpinnings that have sculpted the tree of life.”
*Thread Reply:* And if someone has sessions where palaeoproteomics fit, feel free to send them to me and I'll pass them on to PAASTA (we don't have an emailing list yet) 😊
*Thread Reply:* Get a mailing list!
*Thread Reply:* Sssscchhh we're working on it!
*Thread Reply:* Also welcome back to spaam 😏
*Thread Reply:* I never left. Just turned into a lurker.
Dear @channel 🥳
I would also like to advertise our session at the EAA 2024 :meow_party: :
Session 122: Indicators of Nonprivileged Populations from Funerary Contexts: Multidisciplinary Approaches to Assessing Disparities in Past Populations
Keywords: Inequality, dietary stable isotopes, paleogenomics, paleopathology, funerary archaeology, bioarchaeology
We are hoping for a very diverse session full of interdisciplinary contributions, so please don't feel shy and send us some abstracts :party_dino: If you have any questions, feel free to contact me. Deadline for the abstract submission is: 8. 2. 2024.
*Thread Reply:* Very helpful, thanks a lot!
*Thread Reply:* Thanks @James Fellows Yates! We use it as general reference for master students to practice indeed. Not really up-to-date in some parts, but I promised myself to refresh it soon. Tips/comments/corrections are welcome! Hope this helps!
*Thread Reply:* Great to have everything open 😄 💪
Hi @channel -- This is Ian, the SPAAM secretary. I am here to ask you to fill in a very (very very) short form which will help us fulfill our reporting obligations to ISBA. The form can be completed in <1minute and collects basic information about which institutes we represent. Your name and contact details will not be collected with the form.
Please take a moment to fill it out when you can! Thanks so much!
https://forms.gle/kFTPJBkvEHqP72oM7
🎉 🦠 :flag_mx:
@channel Abstract submissions are OPEN for SMBE 2024 and due March 15! Submit here: https://smbe2024registration.org/abstracts We will have a symposium called “Unveiling the evolutionary history of pathogens through paleogenomics” with invited speakers Dr. Tanvi Honap and Dr. Elizabeth Nelson. SMBE 2024 will be in Puerto Vallarta, Mexico from July 7-11, 2024. More info: https://smbe2024.org/
¡Nos vemos en Puerto Vallarta! @Miriam Bravo, @Gunnar Neumann, @aidanva, and Shreya 🧬 🦷 🏝️
Hi @channel -- Just another ping about the demographics form -- it really takes only 30 seconds! Thanks to everyone who has already filled it out. It is important that we get as close to the entire community as possible!
Please take a moment to fill it out when you can! Thanks so much!
https://forms.gle/kFTPJBkvEHqP72oM7
Dear @channel,
I would like to raise your awareness about a meeting related to our first community project, AncientMetagenomeDir (found here #ancientmetagenomedir).
The project is up and running since July 2020 and has served as a great example of how the engagement of many members of the SPAAM community across multiple institutes can lead to great resource for information for the whole field of ancient DNA. Its companion publication (https://www.nature.com/articles/s41597-021-00816-y) has been cited almost 20 times in the three years since its publication.
However, we, the organisational team of AMDir, realised in the last couple of months a decrease in the community participation in the project. We are aware that this is a common phenomenon of any voluntarily run project but we would like to change this. 🙂 @James Fellows Yates and I have brainstormed some ideas that we would like to discuss with everyone who would be interesting in contributing to this resource in the future.
If you are interested to hear and discuss about the next steps in the AMDir development, please fill out this when2meet poll and mark your availability for such a meeting: https://www.when2meet.com/?24332943-5AThg In case you are interested, but cannot make any of the proposed dates, please let me know directly.
I am looking forward to discussing the future of AMDir with many of you!
*Thread Reply:* Hi James - I wonder what's the cost associated with the online summer school? Will need 💰 support from my supervisor! :party_dino:
*Thread Reply:* 0 cost, it's free!
*Thread Reply:* @James Fellows Yates Thanks!!!! whoo whoo
*Thread Reply:* Hi, damn I missed the application deadline 😔 I would be super interested to join online, does it make sense to send application anymore?
*Thread Reply:* You've not missed it, it's open until 31st of may :)
*Thread Reply:* Applications are still open!
Hi everyone,
This is just a short reminder for the topic of discussing the future of AncientMetagenomeDir: https://spaam-community.slack.com/archives/CPYE64ZC6/p1711540972353019 If you haven't added your availability yet, please do so here (https://www.when2meet.com/?24332943-5AThg) by tomorrow evening. I will close the poll and announce the data on Friday, Apr 5th.
}
*Thread Reply:* Wait so it's 2 pm CEST? I was confused when the meeting said, starts in 1h 😅
Hi @channel! The SPAAM5 committee is planning an online FAQ session for you to meet experts in different topics of the field of ancient metagenomics. Please sign up, if you are interested in a personal one-on-one discussion with experts in your field to discuss questions which might have come up during your work.
Registration link: https://forms.gle/7CBh5R4Eqhk1dYAJ6
Date of the FAQ session: June 10th from 2 to 6pm CEST (Note that some experts will be available at a different date, preliminary June 14th)
Wetlab protocols - Rodrigo Barquera nf-core/eager - James Fellows Yates aMeta - Zoé Pochon Microbiome classification/analysis - Irina Velsko Pathogens - Meriam Guellil De novo assembly - Alexander Hübner sedaDNA - Peter D. Heintzman Environmental microbes - Antonio Fernandez Guerra
@channel please sign up if you are interested in joining! Deadline is the May 6th 🌟
Hi all!
Just a reminder you have less than a month to apply for this year's SPAAM summer school!
https://spaam-community.slack.com/archives/CPYE64ZC6/p1712050603518269
Cheers, Ja,es
@channel Deadline extended to May 9th! Please sign up if you are interested in joining! 🌟
Here is the flyer! You can also just register here!!!
📣 :spaam:Hello from the SPAAM Steering Committee! :spaam:@channel!
:partydino:Enjoy reading the SPAAM Newsletter #4 and until next time ---> access through this link👉:skintone_6: https://preview.mailerlite.io/preview/646990/emails/120826521034163946
The large sections are:
- Announcements 🔈
- Upcoming conferences ✈️
- Community initiatives 🤝
- Open job positions :catjam:
- Recent publications 📜
P.S. If you want us to advertise any SPAAM relevant jobs offers, articles, conferences, workshops etc. in our upcoming newsletters, please contact us directly.
Your SPAAM Steering Committee Miriam, @Ian Light, @aidanva, @Maria Lopopolo, @Kadir Toykan Özdoğan, @Betsy Nelson, @Shreya and @Gunnar Neumann.
@channel For those who registered for the cross-community webinar, we are starting in 10 minutes! Feel free to start joining the Zoom link already you should've got from Victoria Mullin (AaRC)
https://spaam-community.slack.com/archives/CPYE64ZC6/p1715157331103869
}
*Thread Reply:* Definitely posted that in the wrong slack chat!!
*Thread Reply:* Tee-hee, I thought so 😬
*Thread Reply:* It's a cool idea though! Maybe @Miriam Bravo should set this up for spaam, like profiling members of the community to help everyone get to know each other a bit more
*Thread Reply:* Sure ! Sounds good , I’ll look more into that !
*Thread Reply:* My wild guess was that it was the mummies group, at least from the university website, but I'm also wondering
Hi everyone!
I just want to introduce to you the latest member of the <#C05F0URFJ7M|little-book-smiley-plots> family! Created by the wonderful @AK Runge and @Petra Korlevic!
Meet Sebastian Sprudelwasster, and Sasha! Who represent weird damag epatterns from proof-reading enzymes, and insufficient reads respectively
If you're interested in contributing either your own weird damage plots, but also in particular little characters (quality is not important!) please head over to <#C05F0URFJ7M|little-book-smiley-plots> and let us know and we can give you instructions on what to do :)
Reminder that the summer school applications close end of this week!!
Hi @channel! We are very excited to announce a new event: Speed networking between PIs and young researchers! We will group PIs and young researchers into pairs/small groups in breakout rooms to share a bit about their background, all within a limited amount of time. We have planned this event to replicate the informal networking that happens in a conference but from the comfort of your own house 😉
The first date for this event series would be the 17th of July at 16:00 CEST (Paris time)! Come to talk with: • Prof. Anne Stone (Arizona State University, https://stone.lab.asu.edu/). Topics: ancient pathogens, mycobacteria, primate variation, human population history, forensics. • Associate Prof. Dr. Christina Warinner (Ph.D.) (Harvard University, Max Planck Institute for Evolutionary Anthropology, https://christinawarinner.com/ ). Topics: oral microbiome, gut microbiome, food culture through microbes, proteomics, human adaptation to extreme environments • Dr. Nicolás Rascovan (Institut Pasteur, https://research.pasteur.fr/en/team/microbial-paleogenomics/). Topics: oral microbiome, ancient pathogens, human population genetics, evolution • Dr. Katerina Guschanski (The University of Edinburgh, Uppsala University, https://www.uu.se/en/contact-and-organisation/staff?query=N14-1484). Topics: microbiome, evolution, ecology, nonhuman primates, biological diversity This is your chance to get to talk to them in an informal setting, to ask them any questions and see if they may be a good fit for your future career! If you are interested in participating, please fill out the registration form by July 10th.
@channel I'm writing this as a part of my role of ISBA webmaster (the society that spaam is affiliated under).
If you hadn't already heard, Slack is changing their policy to not just hide all old messages after 90 days, but they will from August will delete all messages older than 90 days.
This is really really bad for us in terms of the slack being a useful knowledge source.
Therefore the ISBA society is currently considering moving to a matrix /element server (https://element.io/). This is a much cheaper alternative and means we retain control over our data (can't be locked behind a pay wall). One downside is that we have to maintain this ourselves (i.e. stability will not be guaranteed in the same way as a large and rich commercial company can).
I would like to ask for your opinion again as this has now become more pressing.
I will an (anon) poll below i would appreciate you to give feedback.
You can also leave comments under this thread if you want to give more specific things
My understanding is than slack will delete everything older than one year not 90 days and this only for the free version. https://slack.com/help/articles/29414264463635-Updates-to-message-and-file-history-on-free-workspaces
*Thread Reply:* Sorry yes, 1 year. But we are on the free version so would still affect us
*Thread Reply:* Are you sure? Because i can see 2023 content in this channel..
*Thread Reply:* We are currently on a 1 month trial 😅
*Thread Reply:* So not surprising 😬
*Thread Reply:* We are definitely not paying for anything
If moving to element is going to happen then consider exporting the workspace info could be useful https://slack.com/help/articles/204897248-Guide-to-Slack-import-and-export-tools
*Thread Reply:* Yes, I already do this every time we have a pro trial 🤣
@channel
}